How can I in R predefine patterns that I would like to keep in a string a then in a column of a data frame?
g <- c("3+kk120", "3+1121", "1+170", "1+kk5")
# I want to get
c("3+kk", "3+1", "1+1", "1+kk")
I am not quite sure if I understand you but, after replacing two digits (kk) into one (X) you can use substr(). Then you can replace back the previous one as follows,
sub("X","kk",substr(sub("kk","X",g),1,3))
gives,
# [1] "3+kk" "3+1" "1+1" "1+kk"
Related
I am trying to match DNA sequences in a column. I am trying to find the longer version of itself, but also in this column it has the same sequence.
I am trying to use Str_which for which I know it works, since if I manually put the search pattern in it finds the rows which include the sequence.
As a preview of the data I have:
SNID type seqs2
9584818 seqs TCTTTCTTTAAGACACTGTCCCAAGCTGAAAGGGAACCTACCAAAGAAACTTCTTCATCTRAGGAATCTACTTATATGTGAGTGCAATGAACTTGTAGATTCTGCTCCTGGGGCCACAGAA
9584818 reversed TTCTGTGGCCCCAGGAGCAGAATCTACAAGTTCATTGCACTCACATATAAGTAGATTCCTYAGATGAAGAAGTTTCTTTGGTAGGTTCCCTTTCAGCTTGGGACAGTGTCTTAAAGAAAGA
9562505 seqs GTCTTCAGCATCTTTCTTTAAGACACTGTCCCAAGCTGAAAGGGAACCTACCAAAGAAACTTCTTCATCTRAGGAATCTACTTATATGTGAGTGCAATGAACTTGTAGATTCTGCTCCTGGGGCCACAGAACTTTGTGAAT
9562505 reversed ATTCACAAAGTTCTGTGGCCCCAGGAGCAGAATCTACAAGTTCATTGCACTCACATATAAGTAGATTCCTYAGATGAAGAAGTTTCTTTGGTAGGTTCCCTTTCAGCTTGGGACAGTGTCTTAAAGAAAGATGCTGAAGAC
Using a simple search of row one as x
x <- "TCTTTCTTTAAGACACTGTCCCAAGCTGAAAGGGAACCTACCAAAGAAACTTCTTCATCTRAGGAATCTACTTATATGTGAGTGCAATGAACTTGTAGATTCTGCTCCTGGGGCCACAGAA"
str_which(df$seqs2, x)
I get the answer I expect:
> str_which(df$seqs3, x)
[1] 1 3
But when I try to search as a whole column, I just get the result of the rows finding itself. And not the other rows in which it is also stated.
> str_which(df$seqs2, df$seqs2)
[1] 1 2 3 4
Since my data set is quite large, I do not want to do this manually, and rather use the column as input, and not just state "x" first.
Anybody any idea how to solve this? I have tried most Stringr cmds by now, but by mistake I might have did it wrongly or skipped some important ones.
Thanks in advance
You may need lapply :
lapply(df$seqs2, function(x) stringr::str_which(df$seqs2, x))
You can also use grep to keep this in base R :
lapply(df$seqs2, function(x) grep(x, df$seqs2))
I am trying to get anything existing between sample_id= and ; in a vector like this:
sample_id=10221108;gender=male
tissue_id=23;sample_id=321108;gender=male
treatment=no;tissue_id=98;sample_id=22
My desired output would be:
10221108
321108
22
How can I get this?
I've been trying several things like this, but I don't find the way to do it correctly:
clinical_data$sample_id<-c(sapply(myvector, function(x) sub("subject_id=.;", "\\1", x)))
You could use sub with a capture group to isolate that which you are trying to match:
out <- sub("^.*\\bsample_id=(\\d+).*$", "\\1", x)
out
[1] "10221108" "321108" "22"
Data:
x <- c("sample_id=10221108;gender=male",
"tissue_id=23;sample_id=321108;gender=male",
"treatment=no;tissue_id=98;sample_id=22")
Note that the actual output above is character, not numeric. But, you may easily convert using as.numeric if you need to do that.
Edit:
If you are unsure that the sample IDs would always be just digits, here is another version you may use to capture any content following sample_id:
out <- sub("^.*\\bsample_id=([^;]+).*$", "\\1", x)
out
You could try the str_extract method which utilizes the Stringr package.
If your data is separated by line, you can do:
str_extract("(?<=\\bsample_id=)([:digit:]+)") #this tells the extraction to target anything that is proceeded by a sample_id= and is a series of digits, the + captures all of the digits
This would extract just the numbers per line, if your data is all collected like that, it becomes a tad more difficult because you will have to tell the extraction to continue even if it has extracted something. The code would look something like this:
str_extract_all("((?<=sample_id=)\\d+)")
This code will extract all of the numbers you're looking for and the output will be a list. From there you can manipulate the list as you see fit.
Task
I am attempting to use better functionality (loop or vector) to parse down a larger list into 26(maybe 27) smaller lists based on each letter of the alphabet (i.e. the first list contains all entries of the larger list that start with the letter A, the second list with the letter B ... the possible 27th list contains all remaining entries that use either numbers of other characters).
I am then attempting to ID which names on the list are similar by using the adist function (for instance, I need to correct company names that are misspelled. e.g. Companyy A needs to be corrected to Company A).
Code thus far
#creates a vector for all uniqueID/stakeholders whose name starts with "a" or "A"
stakeA <- grep("^[aA].*", uniqueID, value=TRUE)
#creates a distance matrix for all stakeholders whose name starts with "a" or "A"
stakeAdist <- (adist(stakeA), ignore.case=TRUE)
write.table(stakeAdist, "test.csv", quote=TRUE, sep = ",", row.names=stakeA, col.names=stakeA)
Explanation
I was able to complete the first step of my task using the above code; I have created a list of all the entries that begin with the letter A and then calculated the "distance" between each entry (appears in a matrix).
Ask One
I can copy and paste this code 26 times and move my way through the alphabet, but I figure that is likely a more elegant way to do this, and I would like to learn it!
Ask Two
To "correct" the entries, thus far I have resorted to writing a table and moving to Excel. In Excel I have to insert a row entry to have the matrix properly align (I suppose this is a small flaw in my code). To correct the entries, I use conditional formatting to highlight all instances where adist is between say 1 and 10 and then have to manually go through the highlights and correct the lists.
Any help on functions / methods to further automate this / better strategies using R would be great.
It would help to have an example of your data, but this might work.
EDIT: I am assuming your data is in a data.frame named df
for(i in 1:26) {
stake <- subset(df, uniqueID==grep(paste0('^[',letters[i],LETTERS[i],'].*'), df$uniqueID, value=T))
stakeDist <- adist(stakeA,ignore.case=T)
write.table(stakeDist, paste0("stake_",LETTERS[i],".csv"), quote=T, sep=',')
}
Using a combination of paste0, and the builtin letters and LETTERS this creates your grep expression.
Using subset, the correct IDs are extracted
paste0 will also create a unique filename for write.table().
And it is all tied together using a for()-loop
I have several datafiles, which I need to process in a particular order. The pattern of the names of the files is, e.g. "Ad_10170_75_79.txt".
Currently they are sorted according to the first numbers (which differ in length), see below:
f <- as.matrix (list.files())
f
[1] "Ad_10170_75_79.txt" "Ad_10345_76_79.txt" "Ad_1049_25_79.txt" "Ad_10531_77_79.txt"
But I need them to be sorted by the middle number, like this:
> f
[1] "Ad_1049_25_79.txt" "Ad_10170_75_79.txt" "Ad_10345_76_79.txt" "Ad_10531_77_79.txt"
As I just need the middle number of the filename, I thought the easiest way is, to get rid of the rest of the name and renaming all files. For this I tried using strsplit (plyr).
f2 <- strsplit (f,"_79.txt")
But I'm sure there is a way to sort the files directly, without renaming all files. I tried using sort and to describe the name with regex but without success. This has been a problem for many days, and I spent several hours searching and trying, to solve this presumably easy task. Any help is very much appreciated.
old example dataset:
f <- c("Ad_10170_75_79.txt", "Ad_10345_76_79.txt",
"Ad_1049_25_79.txt", "Ad_10531_77_79.txt")
Thank your for your answers. I think I have to modify my example, because the solution should work for all possible middle numbers, independent of their digits.
new example dataset:
f <- c("Ad_10170_75_79.txt", "Ad_10345_76_79.txt",
"Ad_1049_9_79.txt", "Ad_10531_77_79.txt")
Here's a regex approach.
f[order(as.numeric(gsub('Ad_\\d+_(\\d+)_\\d+\\.txt', '\\1', f)))]
# [1] "Ad_1049_9_79.txt" "Ad_10170_75_79.txt" "Ad_10345_76_79.txt" "Ad_10531_77_79.txt"
Try this:
f[order(as.numeric(unlist(lapply(strsplit(f, "_"), "[[", 3))))]
[1] "Ad_1049_25_79.txt" "Ad_10170_75_79.txt" "Ad_10345_76_79.txt" "Ad_10531_77_79.txt"
First we split by _, then select the third element of every list element, find the order and subset f based on that order.
I would create a small dataframe containing filenames and their respective extracted indices:
f<- c("Ad_10170_75_79.txt","Ad_10345_76_79.txt","Ad_1049_25_79.txt","Ad_10531_77_79.txt")
f2 <- strsplit (f,"_79.txt")
mydb <- as.data.frame(cbind(f,substr(f2,start=nchar(f2)-1,nchar(f2))))
names(mydb) <- c("filename","index")
library(plyr)
arrange(mydb,index)
Take the first column of this as your filename vector.
ADDENDUM:
If a numeric index is required, simply convert character to numeric:
mydb$index <- as.numeric(mydb$index)
I am reading this from a CSV file, and i need to write a function that churns out a final data frame, so given a particular entry, i have
x
[1] {2,4,5,11,12}
139 Levels: {1,2,3,4,5,6,7,12,17} ...
i can change it to
x2<-as.character(x)
which gives me
x
[1] "{2,4,5,11,12}"
how do i extract 2,4,5,11,12 out? (having 5 elements)
i have tried to use various ways, like gsub, but to no avail
can anyone please help me?
It sounds like you're trying to import a database table that contains arrays. Since R doesn't know about such data structures, it treats them as text.
Try this. I assume the column in question is x. The result will be a list, with each element being the vector of array values for that row in the table.
dat <- read.csv("<file>", stringsAsFactors=FALSE)
dat$x <- strsplit(gsub("\\{(.*)\\}", "\\1", dat$x), ",")