I made a CSV and I used it for a data driven test in Katalon.
x,y
house,way
1,2
Run the test and the test runs three times, however, I stored two valid data inputs (house, way; 1,2)?
I don't know why this happened.
Its your CVS file, its got extra line or CR at the end, use notepad to delete all empty space and line after the last character of 2nd line. Also remember to delete and reload the file in Data Driven
Related
I have several excel files I need to read, but in some of them the results start in row 41 in others in 48. Though all start after one single empty row. How can I write a code to read every file after this empty row?
here is an example: my data start from row 41. The name of the cell is the same, it's the position that changes
How can you loop through a paired-end fastq file? For single end reads you can do the following
library(ShortRead)
strm <- FastqStreamer("./my.fastq.gz")
repeat {
fq <- yield(strm)
if (length(fq) == 0)
break
#do things
writeFasta(fq, 'output.fq', mode="a")
}
However, if I edit one paired-end file, I somehow need to keep track of the second file so that the two files continue to correspond well with each other
Paired-end fastq files are typically ordered,
So you could keep track of the lines that are removed, and remove them from the paired file. But this isn't a great method, and if your data is line-wrapped you will be in pain.
A better way would be to use the header information.
The headers for the paired reads in the two files are identical, except for the field that specifies whether the read is reverse or forward (1 or 2)...
first read from file 1:
#M02621:7:000000000-ARATH:1:1101:15643:1043 1:N:0:12
first read from file 2
#M02621:7:000000000-ARATH:1:1101:15643:1043 2:N:0:12
The numbers 1101:15643:1043 refers to the tile and x, y coordinates on that tile, respectively.
These numbers uniquely identify each read pair, for the given run.
Using this information, you can removed reads from the second file if they are not in the first file.
Alternatively, if you are doing quality trimming... Trimmomatic can perform quality/length filtering on paired-end data, and it's fast...
Good morning.
First things first: I know next to nothing about shell scripting in Unix, so please pardon my naivety.
Here's what I'd like to do, and I think it's relatively simple: I would like to create a .ksh file to do two things: 1) take a user-provided numerical value (argument) and paste it into a new column at the end of a dataset (a separate .txt file), and 2) execute a different .ksh script.
I envision calling this script at the Unix prompt, with the input value added thereafter. Something like, "paste_and_run.ksh 58", where 58 would populate a new, final (un-headered) column in an existing dataset (specifically, it'd populate the 77th column).
To be perfectly honest, I'm not even sure where to start with this, so any input would be very appreciated. Apologies for the lack of code within the question. Please let me know if I can offer any more detail, and thank you for taking a look.
I have found the answer: the "nawk" command.
TheNumber=$3
PE_Infile=$1
Where the above variables correspond to the third and first arguments from the command line, respectively. "PE_Infile" represents the file (with full path) to be manipulated, and "TheNumber" represents the number to populate the final column. Then:
nawk -F"|" -v TheNewNumber=$TheNumber '{print $0 "|" TheNewNumber/10000}' $PE_Infile > $BinFolder/Temp_Input.txt
Here, the -F"|" dictates the delimiter, and the -v dictates what is to be added. For reasons unknown to myself, the declaration of a new varible (TheNewNumber) was necessary to perform the arithmetic manipulation within the print statement. print $0 means that the whole line would be printed, while tacking the "|" symbol and the value of the command line input divided by 10000 to the end. Finally, we have the input file and an output file (Temp_PE_Input.txt, within a path represented by the $Binfolder variable).
Running the desired script afterward was as simple as typing out the script name (with path), and adding corresponding arguments ($2 $3) afterward as needed, each separated by a space.
I have two files containing biological DNA sequence data. Each of these files are the output of a python script which assigns each DNA sequence to a sample ID based on a DNA barcode at the beginning of the sequence. The output of one of these .txt files looks like this:
>S066_1 IGJRWKL02G0QZG orig_bc=ACACGTGTCGC new_bc=ACACGTGTCGC bc_diffs=0
TTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCGTGAGAAGTTGAGGTTATGGCAAGCATCCATAAGAACCCTATAGCGAGAATAATTACTACGCTTAGAGCCAGATGGCACCGCCACTGATTTTAGGGGCCGCTGAATAGCGAGCTCCAAGACCCCTTGCGGGATTGGTCAAAATAGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTCCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCAGCGTTCTTCATCGATGACGAGTCTAG
>S045_2 IGJRWKL02H5XHD orig_bc=ATCTGACGTCA new_bc=ATCTGACGTCA bc_diffs=0
CTAAGTTCAGCGGGTAGTCTTGTCTGATATCAGGTCCAATTGAGATACCACCGACAATCATTCGATCATCAACGATACAGAATTTCCCAAATAAATCTCTCTACGCAACTAAATGCAGCGTCTCCGTACATCGCGAAATACCCTACTAAACAACGATCCACAGCTCAAACCGACAACCTCCAGTACACCTCAAGGCACACAGGGGATAGG
The first line is the sequence ID, and the second line in the DNA sequence. S_066 in the first part of the ID indicates that the sequence is from sample 066, and the _1 indicates that its the first sequence in the file (not the first sequence from S_066 per se). Because of the nuances of the DNA sequencing technology being used, I need to generate two files like this from the raw sequencing files, and the result is an output where I have two of these files, which I then use cat to merge together. So far so good.
The next downstream step in my workflow does not allow identical sample names. Right now it gets half way through, errors, and closes because it encounters some identical sequence IDs. So, it must be that the 400th sequence in both files belongs to the same sample, or something, generating identical sample IDs (i.e. both files might have S066_400).
What I would like to do is use some code to insert a number (1000,, 4971, whatever) immediately after the _ on every other line in the second file, starting with the first line. This way the IDs would no longer be confounded and I could proceed. So, it would cover S066_2 to S066_24971 or S066_49712. Part of the trouble is that the ID may be variable in length such that it could begin as S066_ or as 49BBT1_.
Try:
awk '/^\>/ {$1=$1 "_13"} {print $0}' filename > tmp.tmp
mv tmp.tmp filename
Setting:
I have (simple) .csv and .dat files created from laboratory devices and other programs storing information on measurements or calculations. I have found this for other languages but nor for R
Problem:
Using R, I am trying to extract values to quickly display results w/o opening the created files. Hereby I have two typical settings:
a) I need to read a priori unknown values after known key words
b) I need to read lines after known key words or lines
I can't make functions such as scan() and grep() work.
c) Finally I would like to loop over dozens of files in a folder and give me a summary (to make the picture complete: I will manage this part)
I woul appreciate any form of help.
ok, it works for the key value (although perhaps not very nice)
variable<-scan("file.csv", what=character(),sep="")
returns a charactor vector of everything
variable[grep("keyword", ks)+2] # + 2 as the actual value is stored two places ahead
returns characters of seaked values.
as.numeric(lapply(variable, gsub, patt=",", replace="."))
for completion: data had to be altered to number and "," and "." problem needed to be solved.
in a line:
data=as.numeric(lapply(ks[grep("Ks_Boden", ks)+2], gsub, patt=",", replace="."))
Perseverence is not to bad of an asset ;-)
The rest isn't finished, yet, I will post once finished.