Is there an efficient way of programming to solve the following task?
Imagine the following vector:
A<-[a,b,c...k]
And would like to spread it the following way:
Let‘s start with e.g. n=2
B<-[a,a,b,b,c...,k,k]
And now n=4 or any number greater 1
C<-[a,a,a,a,b,...,k,k,k,k]
To solve it via loops seems kind of easy, but is there any function or vector based operation I missed/could use? A tidyverse solutions (for using it in a pipe) would be the best solution for me.
(It is hard to do research on this task as I am a newbie in R and don‘t the correct terms to search for. Any help would be helpful.)
Let
A <- letters[1:11]
A
[1] "a" "b" "c" "d" "e" "f" "g" "h" "i" "j" "k"
If you use function rep with argument each, you get what you want:
rep(A, each=2)
[1] "a" "a" "b" "b" "c" "c" "d" "d" "e" "e" "f" "f" "g" "g" "h" "h" "i" "i" "j"
[20] "j" "k" "k"
rep(A, each=3)
[1] "a" "a" "a" "b" "b" "b" "c" "c" "c" "d" "d" "d" "e" "e" "e" "f" "f" "f" "g"
[20] "g" "g" "h" "h" "h" "i" "i" "i" "j" "j" "j" "k" "k" "k"
An option is to use rep with argument times = 2 or 4 and then sort the result. Another option is to use mapply and then c operator.
c(mapply(rep, 2 ,A)) # OR sort(rep(A, times = 2))
#[1] "a" "a" "b" "b" "c" "c" "d" "d" "e" "e" "f" "f" "g" "g" "h" "h" "i" "i" "j" "j"
#[21] "k" "k"
c(mapply(rep,A, 4)) #OR sort(rep(A, times = 2))
#[1] "a" "a" "a" "a" "b" "b" "b" "b" "c" "c" "c" "c" "d" "d" "d" "d" "e" "e" "e" "e"
#[21] "f" "f" "f" "f" "g" "g" "g" "g" "h" "h" "h" "h" "i" "i" "i" "i" "j" "j" "j" "j"
#[41] "k" "k" "k" "k"
Related
Suppose I have a vector in R:
x<-c("a", "b", "c;d", "e", "f;g;h;i;j")
My question is how to expand x by the seperator ";", namely a desired output would be:
x
[1] "a" "b" "c" "d" "e" "f" "g" "h" "i" "j"
With strsplit:
unlist(strsplit(x, split = ";"))
# [1] "a" "b" "c" "d" "e" "f" "g" "h" "i" "j"
I am trying to convert my_dnabin1, a DNAbin file of 55 samples, to fasta format. I am using the following code to convert it into a fasta file.
dnabin_to_fasta <- lapply(my_dnabin1, function(x) as.character(x[1:length(x)]))
This generates a list of 55 samples which looks like:
$SS.11.01
[1] "t" "t" "a" "c" "c" "t" "a" "a" "a" "a" "a" "g" "c" "c" "g" "c" "t" "t" "c" "c" "c" "t" "c" "c" "a" "a"
[27] "c" "c" "c" "t" "a" "g" "a" "a" "g" "c" "a" "a" "a" "c" "c" "t" "t" "t" "c" "a" "a" "c" "c" "c" "c" "a"
$SS.11.02
[1] "t" "t" "a" "c" "c" "t" "a" "a" "a" "a" "a" "g" "c" "c" "g" "c" "t" "t" "c" "c" "c" "t" "c" "c" "a" "a"
[27] "c" "c" "c" "t" "a" "g" "a" "a" "g" "c" "a" "a" "a" "c" "c" "t" "t" "t" "c" "a" "a" "c" "c" "c" "c" "a"
and so on...
However, I want a fasta formatted file as the output that may look something like:
>SS.11.01 ttacctga
>SS.11.02 ttacctga
you can try this
lapply(my_dnabin1, function(x) paste0(x, collapse = ''))
I have huge data set. The columns contain values like A,B,C,D,E,F,G,H and I need to replace them with 1,2,3,4...
[1] "C" "C" "C" "C" "C" "A" "H" "G" "G" "G" "G" "G" "G" "G" "C" "C" "C" "C" "C"
[20] "C" "B" "B" "B" "H" "H" "H" "H" "H" "H" "G" "C" "A" "A" "A" "A" "A" "A" "A"
[30]----
Another similar problem is values in one column are more than 1000 and I need to replace them by unique numbers.
try replace
replace function examples
in your case e.g.
replace(df, "A", 1)
I have the following function (from package seqinr):
translate(seq, frame = 0, sens = "F", numcode = 1, NAstring = "X", ambiguous = FALSE)
Shortly, it translates DNA sequences into protein sequences. I have problems with giving the seq argument. The documentation says:
seq = the sequence to translate as a vector of single characters in lower case letters
I store the DNA sequence in a data.frame (named here seq):
seq <- data.frame(geneSeq="ATGTGTTGGGCAGCCGCAATACCTATCGCTATATCTGGCGCTCAGGCTATCAGTGGTCAGAACACTCAAGCCAAAATGATTGCCGTTCAGACCGCTGCTGGTCGTCGTCAAGCTATGGAAATCATGAGGCAGACGAACATCCAGAATGCTGACCTATCGTTGCAAGCTCGAAGTAACCTTGAGAAAGCGTCCGCCGAGTTGACCTCACAGAACATGCAKAAGGTCCAAGCTATTGGGTCTATCCGAGCGGCTATCGGAGAAAGTATGCTTGAAGGTTCCTCAATGGACCGTATTAAGCGAGTCACAGAAGGACAGTTCATTCGGGAAGCCAATATGGTAACTGAGAACTATCGCCGTGACTACCAAGCAATCTTCGTACAGCAACTTGGTGGTACTCAAAGTGCTGCAAGTCAGATTGACGAAATCTATAAGAGCGAACAGAAACAGAAGAGTAAGCTACAGATGGTTCTGGACCCACTGGCTATCATGGGGTCTTCCGCTGCGAGTGCTTACGCATCCGATGCGTTCGACTCTAAGTTCACAACTAAGGCACCTATTGTTGCCGCTAAAGGAACCAAGACGGGGAGGTAA", stringsAsFactors=FALSE)
Every time I try to use the translate function, it returns the error:
Error in s2n(seq, levels = s2c("tcag")) :
sequence is not a vector of chars
I have tried the following, all give the above error:
trans<- seqinr::translate(tolower(seq[1,1]))
trans<- seqinr::translate(stringr::str_split(tolower(seq[1,1]), pattern=""))
trans<- seqinr::translate(as.character(stringr::str_split(tolower(seq[1,1]), pattern="")))
How can I transform my DNA sequence in a vector of single characters?
You could use strsplit:
strsplit("ABCD", "")
# [[1]]
# [1] "A" "B" "C" "D"
## your example:
seqinr::translate(strsplit(seq[1,1], "")[[1]])
The first example in ?translate pretty much gives you your answer.
You don't need a data frame and can use s2c whose sole purpose in life is for "conversion of a string into a vector of chars":
geneSeq="ATGTGTTGGGCAGCCGCAATACCTATCGCTATATCTGGCGCTCAGGCTATCAGTGGTCAGAACACTCAAGCCAAAATGATTGCCGTTCAGACCGCTGCTGGTCGTCGTCAAGCTATGGAAATCATGAGGCAGACGAACATCCAGAATGCTGACCTATCGTTGCAAGCTCGAAGTAACCTTGAGAAAGCGTCCGCCGAGTTGACCTCACAGAACATGCAKAAGGTCCAAGCTATTGGGTCTATCCGAGCGGCTATCGGAGAAAGTATGCTTGAAGGTTCCTCAATGGACCGTATTAAGCGAGTCACAGAAGGACAGTTCATTCGGGAAGCCAATATGGTAACTGAGAACTATCGCCGTGACTACCAAGCAATCTTCGTACAGCAACTTGGTGGTACTCAAAGTGCTGCAAGTCAGATTGACGAAATCTATAAGAGCGAACAGAAACAGAAGAGTAAGCTACAGATGGTTCTGGACCCACTGGCTATCATGGGGTCTTCCGCTGCGAGTGCTTACGCATCCGATGCGTTCGACTCTAAGTTCACAACTAAGGCACCTATTGTTGCCGCTAAAGGAACCAAGACGGGGAGGTAA"
print(translate(s2c(geneSeq), frame = 0, sens = "F", numcode = 1, NAstring = "X", ambiguous = FALSE)
## [1] "M" "C" "W" "A" "A" "A" "I" "P" "I" "A" "I" "S" "G" "A" "Q" "A" "I" "S" "G" "Q" "N" "T" "Q" "A" "K"
## [26] "M" "I" "A" "V" "Q" "T" "A" "A" "G" "R" "R" "Q" "A" "M" "E" "I" "M" "R" "Q" "T" "N" "I" "Q" "N" "A"
## [51] "D" "L" "S" "L" "Q" "A" "R" "S" "N" "L" "E" "K" "A" "S" "A" "E" "L" "T" "S" "Q" "N" "M" "X" "K" "V"
## [76] "Q" "A" "I" "G" "S" "I" "R" "A" "A" "I" "G" "E" "S" "M" "L" "E" "G" "S" "S" "M" "D" "R" "I" "K" "R"
## [101] "V" "T" "E" "G" "Q" "F" "I" "R" "E" "A" "N" "M" "V" "T" "E" "N" "Y" "R" "R" "D" "Y" "Q" "A" "I" "F"
## [126] "V" "Q" "Q" "L" "G" "G" "T" "Q" "S" "A" "A" "S" "Q" "I" "D" "E" "I" "Y" "K" "S" "E" "Q" "K" "Q" "K"
## [151] "S" "K" "L" "Q" "M" "V" "L" "D" "P" "L" "A" "I" "M" "G" "S" "S" "A" "A" "S" "A" "Y" "A" "S" "D" "A"
## [176] "F" "D" "S" "K" "F" "T" "T" "K" "A" "P" "I" "V" "A" "A" "K" "G" "T" "K" "T" "G" "R" "*"
In R, I need an efficient solution to shuffle the elements contained within a list, preserving the total number of elements, and the local element sizes (in this case, each element of the list is a vector)
a<-LETTERS[1:6]
b<-LETTERS[6:10]
c<-LETTERS[c(9:15)]
l=list(a,b,c)
> l
[[1]]
[1] "A" "B" "C" "D" "E" "F"
[[2]]
[1] "F" "G" "H" "I" "J"
[[3]]
[1] "I" "J" "K" "L" "M" "N" "O"
The shuffling should randomly select the letters of the list (without replacement) and put them in a random position of any vector within the list.
I hope I have been clear! Thanks :-)
you may try recreating a second list with the skeleton of the first, and fill it with all the elements of the first list, like this:
u<-unlist(l)
l2<-relist(u[sample(length(u))],skeleton=l)
> l2
[[1]]
[1] "F" "A" "O" "I" "S" "Q"
[[2]]
[1] "R" "P" "K" "F" "G"
[[3]]
[1] "A" "N" "M" "J" "H" "G" "E" "B" "T" "C" "D" "L"
Hope this helps!
Like this...?
> set.seed(1)
> lapply(l, sample)
[[1]]
[1] "B" "F" "C" "D" "A" "E"
[[2]]
[1] "J" "H" "G" "F" "I"
[[3]]
[1] "J" "M" "O" "L" "N" "K" "I"