When running the PySide Diagram Scene example (circa 2010), I get the error below. Is there a more current example of a basic diagram editor available?
C:\Python34\python.exe C:/Users/dle/Documents/Programming/Python/diagramscene.py
Traceback (most recent call last):
File "C:/Users/dle/Documents/Programming/Python/diagramscene.py", line 11, in <module>
import diagramscene_rc
File "C:\Users\dle\Documents\Programming\Python\diagramscene_rc.py", line 404, in <module>
qInitResources()
File "C:\Users\dle\Documents\Programming\Python\diagramscene_rc.py", line 399, in qInitResources
QtCore.qRegisterResourceData(0x01, qt_resource_struct, qt_resource_name, qt_resource_data)
TypeError: 'qRegisterResourceData' called with wrong argument types:
qRegisterResourceData(int, str, str, str)
Supported signatures:
qRegisterResourceData(int, unicode, unicode, unicode)
The problem is that the file diagramscene_rc.py has been generated for python2, to solve it you must recompile that file for it opens a terminal in the folder and executes the following command:
pyside-rcc diagramscene.qrc -o diagramscene_rc.py -py3
Or, place the letter b before assigning the variable as shown below:
qt_resource_data = "\
\x00\x00\x01\x12\
...
qt_resource_name = "\
\x00\x06\
...
qt_resource_struct = "\
\x00\x00\x00\x00\x00\x02\x00\x00\x00\x01\x00\x00\x00\x01\
....
to:
qt_resource_data = b"\
\x00\x00\x01\x12\
...
qt_resource_name = b"\
\x00\x06\
...
qt_resource_struct = b"\
\x00\x00\x00\x00\x00\x02\x00\x00\x00\x01\x00\x00\x00\x01\
....
Related
I'm trying to use a julia function from a streamlit app. Created a toy example to test the interaction, simply returning a matrix from a julia functions based on a single parameter to specify the value of the diagonal elements.
Will also note at the outset that both julia_import_method = "api_compiled_false" and julia_import_method = "main_include" works when importing the function in Spyder IDE (rather than at the command line to launch the streamlit app via streamlit run streamlit_julia_test.py).
My project directory looks like:
├── my_project_directory
│ ├── julia_test.jl
│ └── streamlit_julia_test.py
The julia function is in julia_test.jl and just simply returns a matrix with diagonals specified by the v parameter:
function get_matrix_from_julia(v::Int)
m=[v 0
0 v]
return m
end
The streamlit app is streamlit_julia_test.py and is defined as:
import os
from io import BytesIO
import numpy as np
import seaborn as sns
import matplotlib.pyplot as plt
import streamlit as st
# options:
# main_include
# api_compiled_false
# dont_import_julia
julia_import_method = "api_compiled_false"
if julia_import_method == "main_include":
# works in Spyder IDE
import julia
from julia import Main
Main.include("julia_test.jl")
elif julia_import_method == "api_compiled_false":
# works in Spyder IDE
from julia.api import Julia
jl = Julia(compiled_modules=False)
this_dir = os.getcwd()
julia_test_path = """include(\""""+ this_dir + """/julia_test.jl\"""" +")"""
print(julia_test_path)
jl.eval(julia_test_path)
get_matrix_from_julia = jl.eval("get_matrix_from_julia")
elif julia_import_method == "dont_import_julia":
print("Not importing ")
else:
ValueError("Not handling this case:" + julia_import_method)
st.header('Using Julia in Streamlit App Example')
st.text("Using Method:" + julia_import_method)
matrix_element = st.selectbox('Set Matrix Diagonal to:', [1,2,3])
matrix_numpy = np.array([[matrix_element,0],[0,matrix_element]])
col1, col2 = st.columns([4,4])
with col1:
fig, ax = plt.subplots(figsize=(5,5))
sns.heatmap(matrix_numpy, ax = ax, cmap="Blues",annot=True)
ax.set_title('Matrix Using Python Numpy')
buf = BytesIO()
fig.savefig(buf, format="png")
st.image(buf)
with col2:
if julia_import_method == "dont_import_julia":
matrix_julia = matrix_numpy
else:
matrix_julia = get_matrix_from_julia(matrix_element)
fig, ax = plt.subplots(figsize=(5,5))
sns.heatmap(matrix_julia, ax = ax, cmap="Blues",annot=True)
ax.set_title('Matrix from External Julia Script')
buf = BytesIO()
fig.savefig(buf, format="png")
st.image(buf)
If the app were working correctly, it would look like this (which can be reproduced by setting the julia_import_method = "dont_import_julia" on line 13):
Testing
When I try julia_import_method = "main_include", I get the well known error:
julia.core.UnsupportedPythonError: It seems your Julia and PyJulia setup are not supported.
Julia executable:
julia
Python interpreter and libpython used by PyCall.jl:
/Users/myusername/opt/anaconda3/bin/python3
/Users/myusername/opt/anaconda3/lib/libpython3.9.dylib
Python interpreter used to import PyJulia and its libpython.
/Users/myusername/opt/anaconda3/bin/python
/Users/myusername/opt/anaconda3/lib/libpython3.9.dylib
Your Python interpreter "/Users/myusername/opt/anaconda3/bin/python"
is statically linked to libpython. Currently, PyJulia does not fully
support such Python interpreter.
The easiest workaround is to pass `compiled_modules=False` to `Julia`
constructor. To do so, first *reboot* your Python REPL (if this happened
inside an interactive session) and then evaluate:
>>> from julia.api import Julia
>>> jl = Julia(compiled_modules=False)
Another workaround is to run your Python script with `python-jl`
command bundled in PyJulia. You can simply do:
$ python-jl PATH/TO/YOUR/SCRIPT.py
See `python-jl --help` for more information.
For more information, see:
https://pyjulia.readthedocs.io/en/latest/troubleshooting.html
As suggested, when I set julia_import_method = "api_compiled_false", I get a seg fault:
include("my_project_directory/julia_test.jl")
2022-04-03 10:23:13.406 Traceback (most recent call last):
File "/Users/myusername/opt/anaconda3/lib/python3.9/site-packages/streamlit/script_runner.py", line 430, in _run_script
exec(code, module.__dict__)
File "my_project_directory/streamlit_julia_test.py", line 25, in <module>
jl = Julia(compiled_modules=False)
File "/Users/myusername/.local/lib/python3.9/site-packages/julia/core.py", line 502, in __init__
if not self.api.was_initialized: # = jl_is_initialized()
File "/Users/myusername/.local/lib/python3.9/site-packages/julia/libjulia.py", line 114, in __getattr__
return getattr(self.libjulia, name)
File "/Users/myusername/opt/anaconda3/lib/python3.9/ctypes/__init__.py", line 395, in __getattr__
func = self.__getitem__(name)
File "/Users/myuserame/opt/anaconda3/lib/python3.9/ctypes/__init__.py", line 400, in __getitem__
func = self._FuncPtr((name_or_ordinal, self))
AttributeError: dlsym(0x21b8e5840, was_initialized): symbol not found
signal (11): Segmentation fault: 11
in expression starting at none:0
Allocations: 35278345 (Pool: 35267101; Big: 11244); GC: 36
zsh: segmentation fault streamlit run streamlit_julia_test.py
I've also tried the alternative recommendation provided in the PyJulia response message regarding the use of:
python-jl my_project_directory/streamlit_julia_test.py
But I get this error when running the python-jl command:
INTEL MKL ERROR: dlopen(/Users/myusername/opt/anaconda3/lib/libmkl_intel_thread.1.dylib, 0x0009): Library not loaded: #rpath/libiomp5.dylib
Referenced from: /Users/myusername/opt/anaconda3/lib/libmkl_intel_thread.1.dylib
Reason: tried: '/Applications/Julia-1.7.app/Contents/Resources/julia/bin/../lib/libiomp5.dylib' (no such file), '/usr/local/lib/libiomp5.dylib' (no such file), '/usr/lib/libiomp5.dylib' (no such file).
Intel MKL FATAL ERROR: Cannot load libmkl_intel_thread.1.dylib.
So I'm stuck, thanks in advance for a modified reproducible example or instructions for the following system specs!
System specs:
Mac OS Monterey 12.2.1 (Chip - Mac M1 Pro)
Python 3.9.7
Julia 1.7.2
PyJulia 0.5.8.dev
Streamlit 1.7.0
yes we can use it streamlit_julia_test.py NumPy for instance
post#1 Learning python.
Using IDLE shell and script, both experience this issue.
Successfully importing "string" module, but calling a function from it returns an error:
from string import *
find("atgacatgcacaagtatgcat","atg")
error:
Traceback (most recent call last):
File "<pyshell#3>", line 1, in <module>
find("atgacatgcacaagtatgcat","atgc")
NameError: name 'find' is not defined
find is a method of the class string. You have to use .find
try below example:
str1 = "atgacatgcacaagtatgcat"
str2 = "atg"
str1.find(str2)
I'm trying to install html5lib. at first I tried to install the latest version (8 or 9 nines), but it came into conflict with my BeautifulSoup, so I decided to try older verison (0.9999999, seven nines ). I installed it, but when I try to use it:
>>> with urlopen("http://example.com/") as f:
document = html5lib.parse(f, encoding=f.info().get_content_charset())
I get an error:
Traceback (most recent call last):
File "<pyshell#11>", line 2, in <module>
document = html5lib.parse(f, encoding=f.info().get_content_charset())
File "C:\Python\Python35-32\lib\site-packages\html5lib\html5parser.py", line 35, in parse
return p.parse(doc, **kwargs)
File "C:\Python\Python35-32\lib\site-packages\html5lib\html5parser.py", line 235, in parse
self._parse(stream, False, None, *args, **kwargs)
File "C:\Python\Python35-32\lib\site-packages\html5lib\html5parser.py", line 85, in _parse
self.tokenizer = _tokenizer.HTMLTokenizer(stream, parser=self, **kwargs)
File "C:\Python\Python35-32\lib\site-packages\html5lib\_tokenizer.py", line 36, in __init__
self.stream = HTMLInputStream(stream, **kwargs)
File "C:\Python\Python35-32\lib\site-packages\html5lib\_inputstream.py", line 151, in HTMLInputStream
return HTMLBinaryInputStream(source, **kwargs)
TypeError: __init__() got an unexpected keyword argument 'encoding'
What is wrong and what should I do?
I see something was broken in the latest versions of html5lib in regard to bs4, html5lib.treebuilders._base is no longer there, usng bs4 4.4.1 the latest compatible version seems to be the one with 7 nines, once you install it as below it works fine:
pip3 install -U html5lib=="0.9999999"
Tested using bs4 4.4.1:
In [1]: import bs4
In [2]: bs4.__version__
Out[2]: '4.4.1'
In [3]: import html5lib
In [4]: html5lib.__version__
Out[4]: '0.9999999'
In [5]: from urllib.request import urlopen
In [6]: with urlopen("http://example.com/") as f:
...: document = html5lib.parse(f, encoding=f.info().get_content_charset())
...:
In [7]:
You can see the change in this commit Rename treebuilders._base to .base to reflect public status the name was changed:
The error you see is because you are still using the newest version, in html5lib/_inputstream.py, HTMLBinaryInputStream has no encoding arg:
class HTMLBinaryInputStream(HTMLUnicodeInputStream):
"""Provides a unicode stream of characters to the HTMLTokenizer.
This class takes care of character encoding and removing or replacing
incorrect byte-sequences and also provides column and line tracking.
"""
def __init__(self, source, override_encoding=None, transport_encoding=None,
same_origin_parent_encoding=None, likely_encoding=None,
default_encoding="windows-1252", useChardet=True):
Setting override_encoding=f.info().get_content_charset() should do the trick.
Also upgrading to the latest version of bs4 works fine with the latest version of html5lib:
In [16]: bs4.__version__
Out[16]: '4.5.1'
In [17]: html5lib.__version__
Out[17]: '0.999999999'
In [18]: with urlopen("http://example.com/") as f:
document = html5lib.parse(f, override_encoding=f.info().get_content_charset())
....:
In [19]:
I've been playing with Python 2.7 for a while, and I'm now tryin to make my own Encryption/Decryption algorithm.
I'm trying to make it support non-Ascii characters.
So this is a part of the dictionnary :
... u'\xe6': '1101100', 'i': '0001000', u'\xea': '1100001', 'm': '0001100', u'\xee': '1100111', 'q': '0010000', 'u': '0010100', u'\xf6': '1110010', 'y': '0011000', '}': '1001111'}
But when I try to convert, by exemple, "é" into binairy, doing
base64 = encrypt[i]
where as encrypt is the name of the dic and i = u"é"
I get this error :
Warning (from warnings module):
File "D:\DeskTop 2\Programs\Projects\4.py", line 174
base64 = encrypt[i]
UnicodeWarning: Unicode equal comparison failed to convert both arguments to Unicode - interpreting them as being unequal
Traceback (most recent call last):
File "D:\DeskTop 2\Programs\Projects\4.py", line 197, in
main()
File "D:\DeskTop 2\Programs\Projects\4.py", line 196, in main
decryption(key, encrypt, decrypt)
File "D:\DeskTop 2\Programs\Projects\4.py", line 174, in decryption
base64 = encrypt[i]
KeyError: '\xf1'
Also, I did start with
# -*- coding: utf-8-*-
Alright, sorry for the useless post.
I found the fix. Basically, I did :
for i in user_input:
base64 = encrypt[i]
but i would be like \0xe
I added
j = i.decode("latin-1")
so j = u"\0xe"
And now it works :D
I'm running R (3.2.2) on a Debian Jessie VPS thanks to rpy2 (2.6.1) through Python (2.7.10).
I have a Flask (0.10.1) application launching R via rpy2 and then loading R package devEMF (2.0.0) to plot various graphics. The aim is to save vector images created thanks to devEMF.
My sample code is:
robjects.r(u'''
suppressPackageStartupMessages(library(qgraph))
suppressPackageStartupMessages(library(devEMF))
emf(file = "''' + pathToSaveGraphEmf + '''", bg = "white", width = 6.25, height = 5.21)
attach(mtcars)
plot(wt,mpg)
dev.off()
''')
And I get the following error message:
/usr/local/lib/python2.7/dist-packages/rpy2/robjects/functions.py:106: UserWarning: Error in axis(side = side, at = at, labels = labels, ...) :
Can't open connection to X server to read font metric information.
res = super(Function, self).__call__(*new_args, **new_kwargs)
/usr/local/lib/python2.7/dist-packages/rpy2/robjects/functions.py:106: UserWarning: In addition:
res = super(Function, self).__call__(*new_args, **new_kwargs)
/usr/local/lib/python2.7/dist-packages/rpy2/robjects/functions.py:106: UserWarning: Warning message:
res = super(Function, self).__call__(*new_args, **new_kwargs)
/usr/local/lib/python2.7/dist-packages/rpy2/robjects/functions.py:106: UserWarning: no DISPLAY variable so Tk is not available
res = super(Function, self).__call__(*new_args, **new_kwargs)
[2016-01-21 20:03:18 +0000] [21430] [ERROR] Error handling request
Traceback (most recent call last):
File "/usr/local/lib/python2.7/dist-packages/gunicorn/workers/sync.py", line 130, in handle
self.handle_request(listener, req, client, addr)
File "/usr/local/lib/python2.7/dist-packages/gunicorn/workers/sync.py", line 171, in handle_request
respiter = self.wsgi(environ, resp.start_response)
File "/usr/local/lib/python2.7/dist-packages/flask/app.py", line 1836, in __call__
return self.wsgi_app(environ, start_response)
File "/usr/local/lib/python2.7/dist-packages/flask/app.py", line 1820, in wsgi_app
response = self.make_response(self.handle_exception(e))
File "/usr/local/lib/python2.7/dist-packages/flask_cors/extension.py", line 110, in wrapped_function
return cors_after_request(app.make_response(f(*args, **kwargs)))
File "/usr/local/lib/python2.7/dist-packages/flask/app.py", line 1403, in handle_exception
reraise(exc_type, exc_value, tb)
File "/usr/local/lib/python2.7/dist-packages/flask/app.py", line 1817, in wsgi_app
response = self.full_dispatch_request()
File "/usr/local/lib/python2.7/dist-packages/flask/app.py", line 1477, in full_dispatch_request
rv = self.handle_user_exception(e)
File "/usr/local/lib/python2.7/dist-packages/flask_cors/extension.py", line 110, in wrapped_function
return cors_after_request(app.make_response(f(*args, **kwargs)))
File "/usr/local/lib/python2.7/dist-packages/flask/app.py", line 1381, in handle_user_exception
reraise(exc_type, exc_value, tb)
File "/usr/local/lib/python2.7/dist-packages/flask/app.py", line 1475, in full_dispatch_request
rv = self.dispatch_request()
File "/usr/local/lib/python2.7/dist-packages/flask/app.py", line 1461, in dispatch_request
return self.view_functions[rule.endpoint](**req.view_args)
File "/usr/local/lib/python2.7/dist-packages/flask_classy.py", line 200, in proxy
response = view(**request.view_args)
File "/routines/routine2.py", line 124, in keyDriverAnalysis
myCorrelationMatrix, rowName, colName = r2.getCorrelationGraph(myCorrelationMethod, myPreparedData, myGroupUserInput, myDependentVariable, myIndependentVariable, myPathToSaveGraph)
File "../graph.py", line 194, in getCorrelationGraph
''')
File "/usr/local/lib/python2.7/dist-packages/rpy2/robjects/__init__.py", line 317, in __call__
res = self.eval(p)
File "/usr/local/lib/python2.7/dist-packages/rpy2/robjects/functions.py", line 178, in __call__
return super(SignatureTranslatedFunction, self).__call__(*args, **kwargs)
File "/usr/local/lib/python2.7/dist-packages/rpy2/robjects/functions.py", line 106, in __call__
res = super(Function, self).__call__(*new_args, **new_kwargs)
RRuntimeError: Error in axis(side = side, at = at, labels = labels, ...) :
Can't open connection to X server to read font metric information.
devEMF needs X11 and Xft (line 35), when not running on OSX or Windows, so I installed it. But now it is unable to connect to the X server. Certainly because the VPS has no GUI feature.
Hopefully I found this very helping SO question, and I understood that I should use virtual framebuffer X11 server.
I tried the advice from the SO question in a command line R session, and it worked ! (Now it outputs an empty file, but it was fully working two minutes ago. (I had downloaded the file, inserted is in an .xls file and my graph was openable and ungroupable.))
But now I have to make it work within rpy2.
I tried the second answer in the previously cited SO question, but it doesn't work because it gives a trick when X11 is problematic when loading but not needed then.
I think where I am now is: how do I launch an R session thanks to rpy2 that will use virtual framebuffer X11 server ?
EDIT0:
I think I found something useful here. It explains how to configure a Virtual Frame Buffer on headless unix servers.
EDIT1:
Eventually, what I have done:
Launch xvfb thanks to the command from the main environment, and bind it to the desired screen (1) (I don't reminder where I found this precise line, but well it can be analyzed thanks to the xvfb documentation):
Xvfb :1 -screen 0 1024x768x16 &
Attach the tmux session, and export the DISPLAY environment variable linked to the correct screen (1):
export DISPLAY=:1
And it works !
Important note: the environment variable should be set inside the session.
Also: I don't have the "launch at boot time" problem mentioned in the link from EDIT0, probably because I am on a VPS (the xvfb-run folder is still in tmp and it seems to run because I can plot and save in .emf ;-) )