I have a .txt file containing text (which I don't want) and 65 tables, as shown below (just the top of the .txt file)
Does anyone know how I can extract only the tables from this text file, such that I can open the resulting .txt file as a data.frame with my 65 tables in R? Above each table is a fixed number of lines (starting with "The result of abcpred on seq..." and ending with "Predicted B cell epitopes") and below each of them is a variable number of lines, depending on how many rows each tables has. Then it comes the next table, and it goes like that until I reach the 65th table.
Given that the tables are the only elements that start with numbers, to grep for integers at the beginning of the line is indeed the best solution. Using the shell (and not R) the command:
grep '^[0-9]' input > output
did exactly what I wanted.
Related
I have got this .txt file outputed by a microscope to process.
#read the .txt file generated by microscope, skipping the first 9 lines of garbage information
df <- read.csv("Objects_Population - AllCells.txt", sep="\t", skip = 9,header=TRUE, fill = T)
Then I started looking at the structure of the dataframe, everything seems fine except I now found an extra column in the end of the data frame named "x.1" and all rows of it are NA values. I don't see this column when I open the .txt file in excel. I suspect the problem has something to do with the column names generated by microscope, they contain quite some special characters
Below is the dataframe read by Excel(only showing the last 2 columns since I have 132 columns, and their names are disgustingly long):
AllCells - Cell Contact Area with Neighbors [%] AllCells - Nucleus Nearest Neighbor Distance [µm]
0 4.82083
21.9512 0
15.7895 0
29.4118 0.584611
0 4.21569
0 1.99599
0 3.50767
...
This has happened to me before but I never took it too serious as I was always interested in a subset of my data frame. Now I'm looking at all columns then this starts to bothering me.
Is there any way I can read them correctly without R attaching that additional "X.1" column in the end? Preferably not manually delete or subset out the last column...
Cheers,
ML
If all other column names are correct, you have probably a trailing \t in the text file. R tries to include it and gives it the generic column name X.1.
You could try and read the file first as 'plain text' and remove the trailing \t and only then use read.csv:
file_connection <- file("Objects_Population - AllCells.txt")
content <- readLines(file_connection )
close(file_connection)
Now we try to get rid of these trailing \t (this might need some testing to fit your needs)
sanitized <- gsub("\\t$", "", content)
And then we read this sanitized string as if it was a file (using the argument text)
df <- read.csv(text=paste0(sanitized, collapse="\n"), sep="\t", skip = 9,header=TRUE, fill = T)
Had that problem too. Fixed it by saving the file as "CSV (MS-DOS (*csv)" instead of what I originally had as "CSV (Comma delimited)(*csv)".
This is almost certainly because you've got an extra empty column in your spreadsheet.
In Excel, open your sheet and press Ctrl-End. If you end up in an empty cell outside the range of your data, there's the problem. Select the column (Ctrl-Space), right-click, and choose Delete.
I also encountered similar problem. I found that three extra columns were created (X, X.1, X.2), after I loaded dataset from excel sheet to R studio.
Steps Followed by me:
a) I went to the excel sheet and selected those three extra columns after last column with actual values in excel sheet. Selected extra 3 columns by keeping cursor on top of columns and then right click the mouse and select delete.
b) Again loaded that excel sheet in R. I did not find those 3 columns.
I have a large text file with 40,000+ sections of output. Each output section is ~150 lines. I want one number from each section to put in a vector. The section I want to parse is shown as below.
Min ChiSq_Th: ith_cs ith_rk
-1 1
chisq_th chisq_th_min chisq_th_max ftmp_imv fstp_imv
0.149282D+05 0.200268D+05 0.200268D+05 0.100000D+01 0.100000D+00
I need the number below chisq_th in each sweep. I tried taking every 152nd line but not every sweep is exactly the same. I know R is not the ideal platform for this problem but it is the language I know best.
I have two files containing biological DNA sequence data. Each of these files are the output of a python script which assigns each DNA sequence to a sample ID based on a DNA barcode at the beginning of the sequence. The output of one of these .txt files looks like this:
>S066_1 IGJRWKL02G0QZG orig_bc=ACACGTGTCGC new_bc=ACACGTGTCGC bc_diffs=0
TTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCGTGAGAAGTTGAGGTTATGGCAAGCATCCATAAGAACCCTATAGCGAGAATAATTACTACGCTTAGAGCCAGATGGCACCGCCACTGATTTTAGGGGCCGCTGAATAGCGAGCTCCAAGACCCCTTGCGGGATTGGTCAAAATAGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTCCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCAGCGTTCTTCATCGATGACGAGTCTAG
>S045_2 IGJRWKL02H5XHD orig_bc=ATCTGACGTCA new_bc=ATCTGACGTCA bc_diffs=0
CTAAGTTCAGCGGGTAGTCTTGTCTGATATCAGGTCCAATTGAGATACCACCGACAATCATTCGATCATCAACGATACAGAATTTCCCAAATAAATCTCTCTACGCAACTAAATGCAGCGTCTCCGTACATCGCGAAATACCCTACTAAACAACGATCCACAGCTCAAACCGACAACCTCCAGTACACCTCAAGGCACACAGGGGATAGG
The first line is the sequence ID, and the second line in the DNA sequence. S_066 in the first part of the ID indicates that the sequence is from sample 066, and the _1 indicates that its the first sequence in the file (not the first sequence from S_066 per se). Because of the nuances of the DNA sequencing technology being used, I need to generate two files like this from the raw sequencing files, and the result is an output where I have two of these files, which I then use cat to merge together. So far so good.
The next downstream step in my workflow does not allow identical sample names. Right now it gets half way through, errors, and closes because it encounters some identical sequence IDs. So, it must be that the 400th sequence in both files belongs to the same sample, or something, generating identical sample IDs (i.e. both files might have S066_400).
What I would like to do is use some code to insert a number (1000,, 4971, whatever) immediately after the _ on every other line in the second file, starting with the first line. This way the IDs would no longer be confounded and I could proceed. So, it would cover S066_2 to S066_24971 or S066_49712. Part of the trouble is that the ID may be variable in length such that it could begin as S066_ or as 49BBT1_.
Try:
awk '/^\>/ {$1=$1 "_13"} {print $0}' filename > tmp.tmp
mv tmp.tmp filename
I have a csv file and am unsure how to get R to interpret it as a table because all the title info is in one cell and all the data relating to the titles is in a separate cell. So all the info I need is in 2 cells but it actually needs to be split up.
The cell A3 has a value called 'Team' , this corresponds to the part in the cell A4 that says 'Visitor'. Then each part after than corresponds to the bit below it. ..sorry I don't know how to describe it, but ultimately it would look like this …
Looks like the field separator in your data is a ;
read.csv has a parameter sep to change the field separator and another parameter header to tell it there is an initial line containing the column names. Use read.csv like this:
data = read.csv(file="/mydir/myfile.csv", sep=";", header=T)
To test you can print out the first 5 lines of the data table with:
head(data,5)
I've got text like this in one of my sqlite table columns:
Mantas are found in temperate, subtropical and tropical waters. Both species are pelagic; M. birostris migrates across open oceans, singly or in groups, while M. alfredi tends to be resident and coastal. They are filter feeders and eat large quantities of zooplankton, which they swallow with their open mouths as they swim. Gestation lasts over a year, producing live pups.
Mantas may visit cleaning stations for the removal of parasites. Like whales, they breach, for unknown reasons.
The last two lines are broken from the previous by either a \r or \n. I want to be able to see the actual value of \r or \n in the shell output of of the column. Any ideas?
There doesn't seem to be any way to directly do this in the SQLite shell, but you can use .output <file> to output the result to a file, then use a text or hex editor to see what the line endings are.