I want to remove a part of the rownames in my data frame. I want to remove everything that do not match the string that is defined in the grepl below and replace it with the string defined behind. Does anyone know?
df[grepl(".*lncRNA.*|.*snRNA.*|.*snoRNA.*|.*precursor_RNA.*", rownames(df))] <- c("lncRNA","snRNA","snoRNA","precursor_RNA")
head(rownames(df))
[3208] "URS000075AF9C-snoRNA_GTATGTGTGGACAGCACTGAGACTGAGTCT"
[3209] "URS000075B029-snRNA_AACTCTGAGTCTTAAGCTAATTTTTTGAGGCCTTGTTCCGACA"
[3210] "URS000075B029-snRNA_ATTTCCGTGGAGAGGAACAACTCTGAGTCTTAAGCTAATTT"
[3211] "URS000075B0E3-lncRNA_GTAAGGGGCAGTAAG"
[3212] "URS000075B261-precursor_RNA_CTTTCTATGCTCCTGTTCTGC"
[3213] "URS000075B2ED-lncRNA_CACTCAGGACCCACC"
out
[3208] "snoRNA"
[3209] "snRNA"
[3210] "snRNA"
[3211] "lncRNA"
[3212] "precursor_RNA"
[3213] "lncRNA"
We can use gsub to match one of more characters that are not a - ([^-]+) from the start (^) of the string followed by a - or (|) one or more characters that are not an underscore ([^_]+) until the end of the string ($) and replace it with blanks ("").
gsub("^[^-]+-|_[^_]+$", "", v1)
#[1] "snoRNA" "snRNA" "snRNA" "lncRNA"
#[5] "precursor_RNA" "lncRNA"
If we are doing this on the rownames
gsub("^[^-]+-|_[^_]+$", "", rownames(df))
data
v1 <- c("URS000075AF9C-snoRNA_GTATGTGTGGACAGCACTGAGACTGAGTCT",
"URS000075B029-snRNA_AACTCTGAGTCTTAAGCTAATTTTTTGAGGCCTTGTTCCGACA",
"URS000075B029-snRNA_ATTTCCGTGGAGAGGAACAACTCTGAGTCTTAAGCTAATTT",
"URS000075B0E3-lncRNA_GTAAGGGGCAGTAAG",
"URS000075B261-precursor_RNA_CTTTCTATGCTCCTGTTCTGC",
"URS000075B2ED-lncRNA_CACTCAGGACCCACC")
Welcome to StackOverflow! You've done well with giving us some example input and output, but please consider providing a reproducible example to make it easier for us to help you.
In your case, I think you may be able to use sub, capture the middle, and \1 in the replacement.
x <- c("URS000075AF9C-snoRNA_GTATGTGTGGACAGCACTGAGACTGAGTCT",
"URS000075B029-snRNA_AACTCTGAGTCTTAAGCTAATTTTTTGAGGCCTTGTTCCGACA",
"URS000075B029-snRNA_ATTTCCGTGGAGAGGAACAACTCTGAGTCTTAAGCTAATTT",
"URS000075B0E3-lncRNA_GTAAGGGGCAGTAAG",
"URS000075B261-precursor_RNA_CTTTCTATGCTCCTGTTCTGC",
"URS000075B2ED-lncRNA_CACTCAGGACCCACC")
# replace the string with the captured group (ie regex in brackets)
gsub("^.*(lncRNA|snRNA|snoRNA|precursor_RNA).*$", "\\1", x)
# [1] "snoRNA" "snRNA" "snRNA" "lncRNA"
# [5] "precursor_RNA" "lncRNA"
Rownames have to be unique though, so you may need to store the result in a column of your dataframe instead (or you could use make.unique() to make them unique, but I think saving the result as a column in your dataframe would make more sense).
Related
I have a character string of names which look like
"_6302_I-PAL_SPSY_000237_001"
I need to remove the first occurred underscore, so that it will be as
"6302_I-PAL_SPSY_000237_001"
I aware of gsub but it removes all of underscores. Thank you for any suggestions.
gsub function do the same, to remove starting of the string symbol ^ used
x <- "_6302_I-PAL_SPSY_000237_001"
x <- gsub("^\\_","",x)
[1] "6302_I-PAL_SPSY_000237_001"
We can use sub with pattern as _ and replacement as blanks (""). This will remove the first occurrence of '_'.
sub("_", "", str1)
#[1] "6302_I-PAL_SPSY_000237_001"
NOTE: This will remove the first occurence of _ and it will not limit based on the position i.e. at the start of the string.
For example, suppose we have string
str2 <- "6302_I-PAL_SPSY_000237_001"
sub("_", "", str2)
#[1] "6302I-PAL_SPSY_000237_001"
As the example have _ in the beginning, another option is substring
substring(str1, 2)
#[1] "6302_I-PAL_SPSY_000237_001"
data
str1 <- "_6302_I-PAL_SPSY_000237_001"
This can be done with base R's trimws() too
string1<-"_6302_I-PAL_SPSY_000237_001"
trimws(string1, which='left', whitespace = '_')
[1] "6302_I-PAL_SPSY_000237_001"
In case we have multiple words with leading underscores, we may have to include a word boundary (\\b) in our regex, and use either gsub or stringr::string_remove:
string2<-paste(string1, string1)
string2
[1] "_6302_I-PAL_SPSY_000237_001 _6302_I-PAL_SPSY_000237_001"
library(stringr)
str_remove_all(string2, "\\b_")
> str_remove_all(string2, "\\b_")
[1] "6302_I-PAL_SPSY_000237_001 6302_I-PAL_SPSY_000237_001"
I have a string like word_string. What I want is Word_String. If I use the function str_to_title from stringr, what I get is Word_string. It does not capitalize the second word.
Does anyone know any elegant way to achieve that with stringr? Thanks!
Here is a base R option using sub:
input <- "word_string"
output <- gsub("(?<=^|_)([a-z])", "\\U\\1", input, perl=TRUE)
output
[1] "Word_String"
The regex pattern used matches and captures any lowercase letter [a-z] which is preceded by either the start of the string (i.e. it's the first letter) or an underscore. Then, we replace with the uppercase version of that single letter. Note that the \U modifier to change to uppercase is a Perl extension, so we must use sub in Perl mode.
Can also use to_any_case from snakecase
library(snakecase)
to_any_case(str1, "title", sep_out = "_")
#[1] "Word_String"
data
str1 <- "word_string"
This is obviously overly complicating but another base possibility:
test <- "word_string"
paste0(unlist(lapply(strsplit(test, "_"),function(x)
paste0(toupper(substring(x,1,1)),
substring(x,2,nchar(x))))),collapse="_")
[1] "Word_String"
You could first use gsub to replace "_" by " " and apply the str_to_title function
Then use gsub again to change it back to your format
x <- str_to_title(gsub("_"," ","word_string"))
gsub(" ","_",x)
I have a column as below.
9453, 55489, 4588, 18893, 4457, 2339, 45489HQ, 7833HQ
I would like to add leading zero if the number is less than 5 digits. However, some numbers have "HQ" in the end, some don't.(I did check other posts, they dont have similar problem in the "HQ" part)
so the finally desired output should be:
09453, 55489, 04588, 18893, 04457, 02339, 45489HQ, 07833HQ
any idea how to do this? Thank you so much for reading my post!
A one-liner using regular expressions:
my_strings <- c("9453", "55489", "4588",
"18893", "4457", "2339", "45489HQ", "7833HQ")
gsub("^([0-9]{1,4})(HQ|$)", "0\\1\\2",my_strings)
[1] "09453" "55489" "04588" "18893"
"04457" "02339" "45489HQ" "07833HQ"
Explanation:
^ start of string
[0-9]{1,4} one to four numbers in a row
(HQ|$) the string "HQ" or the end of the string
Parentheses represent capture groups in order. So 0\\1\\2 means 0 followed by the first capture group [0-9]{1,4} and the second capture group HQ|$.
Of course if there is 5 numbers, then the regex isn't matched, so it doesn't change.
I was going to use the sprintf approach, but found the the stringr package provides a very easy solution.
library(stringr)
x <- c("9453", "55489", "4588", "18893", "4457", "2339", "45489HQ", "7833HQ")
[1] "9453" "55489" "4588" "18893" "4457" "2339" "45489HQ" "7833HQ"
This can be converted with one simple stringr::str_pad() function:
stringr::str_pad(x, 5, side="left", pad="0")
[1] "09453" "55489" "04588" "18893" "04457" "02339" "45489HQ" "7833HQ"
If the number needs to be padded even if the total string width is >5, then the number and text need to be separated with regex.
The following will work. It combines regex matching with the very helpful sprintf() function:
sprintf("%05.0f%s", # this encodes the format and recombines the number with padding (%05.0f) with text(%s)
as.numeric(gsub("^(\\d+).*", "\\1", x)), #get the number
gsub("[[:digit:]]+([a-zA-Z]*)$", "\\1", x)) #get just the text at the end
[1] "09453" "55489" "04588" "18893" "04457" "02339" "45489HQ" "07833HQ"
Another attempt, which will also work in cases like "123" or "1HQR":
x <- c("18893","4457","45489HQ","7833HQ","123", "1HQR")
regmatches(x, regexpr("^\\d+", x)) <- sprintf("%05d", as.numeric(sub("\\D+$","",x)))
x
#[1] "18893" "04457" "45489HQ" "07833HQ" "00123" "00001HQR"
This basically finds any numbers at the start of the string (^\\d+) and replaces them with a zero-padded (via sprintf) string that was subset out by removing any non-numeric characters (\\D+$) from the end of the string.
We can use only sprintf() and gsub() by splitting up the parts then putting them back together.
sprintf("%05d%s", as.numeric(gsub("[^0-9]+", "", x)), gsub("[0-9]+", "", x))
# [1] "18893" "04457" "45489HQ" "07833HQ" "00123" "00001HQR"
Using #thelatemail's data:
x <- c("18893", "4457", "45489HQ", "7833HQ", "123", "1HQR")
I used a code of regular expressions which only took stuff before the 2nd occurrence of a dot. The following is the code:-
colnames(final1)[i] <- gsub("^([^.]*.[^.]*)..*$", "\\1", colnames(final)[i])
But now i realized i wanted to take the stuff before the first occurrence of a pattern of 2 dots.
I tried
gsub(",.*$", "", colnames(final)[i]) (changed the , to ..)
gsub("...*$", "", colnames(final)[i])
But it didn't work
The example to try on
KC1.Comdty...PX_LAST...USD......Comdty........
converted to
KC1.Comdty.
or
"LIT.US.Equity...PX_LAST...USD......Comdty........"
to
"LIT.US.Equity."
Can anyone suggest anything?
Thanks
We could use sub to match 2 or more dots followed by other characters and replace it with blank
sub("\\.{2,}.*", "", str1)
#[1] "KC1.Comdty" "LIT.US.Equity"
The . is a metacharacter implying any character. So, we need to escape (\\.) to get the literal meaning of the character
data
str1 <- c("KC1.Comdty...PX_LAST...USD......Comdty.......", "LIT.US.Equity...PX_LAST...USD......Comdty........")
Another solution with strsplit:
str1 <- c("KC1.Comdty...PX_LAST...USD......Comdty.......", "LIT.US.Equity...PX_LAST...USD......Comdty........")
sapply(strsplit(str1, "\\.{2}\\w"), "[", 1)
# [1] "KC1.Comdty." "LIT.US.Equity."
To also include the dot at the end with #akrun's answer, one can do:
sub("\\.{2}\\w.*", "", str1)
# [1] "KC1.Comdty." "LIT.US.Equity."
I have the next vector of strings
[1] "/players/playerpage.htm?ilkidn=BRYANPHI01"
[2] "/players/playerpage.htm?ilkidhh=WILLIROB027"
[3] "/players/playerpage.htm?ilkid=THOMPWIL01"
I am looking for a way to retrieve the part of the string that is placed after the equal sign meaning I would like to get a vector like this
[1] "BRYANPHI01"
[2] "WILLIROB027"
[3] "THOMPWIL01"
I tried using substr but for it to work I have to know exactly where the equal sign is placed in the string and where the part i want to retrieve ends
We can use sub to match the zero or more characters that are not a = ([^=]*) followed by a = and replace it with ''.
sub("[^=]*=", "", str1)
#[1] "BRYANPHI01" "WILLIROB027" "THOMPWIL01"
data
str1 <- c("/players/playerpage.htm?ilkidn=BRYANPHI01",
"/players/playerpage.htm?ilkidhh=WILLIROB027",
"/players/playerpage.htm?ilkid=THOMPWIL01")
Using stringr,
library(stringr)
word(str1, 2, sep = '=')
#[1] "BRYANPHI01" "WILLIROB027" "THOMPWIL01"
Using strsplit,
strsplit(str1, "=")[[1]][2]
# [1] "BRYANPHI01"
With Sotos comment to get results as vector:
sapply(str1, function(x){
strsplit(x, "=")[[1]][2]
})
Another solution based on regex, but extracting instead of substituting, which may be more efficient.
I use the stringi package which provides a more powerful regex engine than base R (in particular, supporting look-behind).
str1 <- c("/players/playerpage.htm?ilkidn=BRYANPHI01",
"/players/playerpage.htm?ilkidhh=WILLIROB027",
"/players/playerpage.htm?ilkid=THOMPWIL01")
stri_extract_all_regex(str1, pattern="(?<==).+$", simplify=T)
(?<==) is a look-behind: regex will match only if preceded by an equal sign, but the equal sign will not be part of the match.
.+$ matches everything until the end. You could replace the dot with a more precise symbol if you are confident about the format of what you match. For example, '\w' matches any alphanumeric character, so you could use "(?<==)\\w+$" (the \ must be escaped so you end up with \\w).