I have got a big file ( arounf 80K lines )
my main goal is to find the patterns and pring for example 10 lines before and 10 lines after the pattern .
the pattern accures multiple times across the file .
using the grep command :
grep -i <my_pattern>* -B 10 -A 10 <my_file>
i get only some of the data , i think it must be something related to the buffer size ....
i need a command ( grep , sed , awk ) that will handle all the matching
and will print 10 line before and after the pattern ...
Example :
my patterns hides here :
a
b
c
pattern_234
c
b
a
a
b
c
pattern_567
c
b
a
this happens multiple times across the file .
running this command :
grep -i pattern_* -B 3 -A 3 <my_file>
will get he right output :
a
b
c
c
b
a
a
b
c
c
b
it works but not full time
if i have 80 patterns not all the 80 will be shown
awk to the rescue
awk -vn=4 # pass the argument of context line count
'{
for(i=1;i<=n;i++) # store the past n lines in an indexed array
p[i]=p[i+1];
p[n+1]=$0
}
/pattern/ # if pattern matched
{
c=n+1; # set the counter to after match line count
for(i=1;i<=n;i++) # print previously saved entries
print p[i]
}
c-->0' # print the lines after match until counter runs out
will print 4 lines before and 4 lines after the match of pattern, change the value of n as per your need.
if non-symmetric before/after you need two variables
awk -vb=2 -va=3 '{for(i=1;i<=b;i++) p[i]=p[i+1];p[b+1]=$0} /pattern/{c=a+1;for(i=1;i<=b;i++) print p[i]} c-->0'
Related
This is actually a continued version of thisquestion:
I have a file
1
2
PAT1
3 - first block
4
PAT2
5
6
PAT1
7 - second block
PAT2
8
9
PAT1
10 - third block
and I use awk '/PAT1/{flag=1; next} /PAT2/{flag=0} flag'
to extract the blocks of lines.
Extracting them works ok, but I'm trying to iterate over these blooks in a block-by-block fashion and do some processing with each block (e.g. save to file, process with other scripts etc.).
How can I construct such a loop?
Problem is not very clear but you may do something like this:
awk '/PAT1/ {
flag = 1
++n
s = ""
next
}
/PAT2/ {
flag = 0
printf "Processing record # %d =>\n%s", n, s
}
flag {
s = s $0 ORS
}' file
Processing record # 1 =>
3 - first block
4
Processing record # 2 =>
7 - second block
This might work for you (GNU sed):
sed -ne '/PAT1/!b;:a;N;/PAT2/!ba;e echo process:' -e 's/.*/echo "&"|wc/pe;p' file
Gather up the lines between PAT1 and PAT2 and process the collection.
In the example above, the literal process: is printed.
The command to print the result of the wc command for the collection is built and printed.
The result of the evaluation of the above command is printed.
N.B. The position of the p flag in the substitution command is critical. If the p is before the e flag the pattern space is printed before the evaluation, if the p flag is after the e flag the pattern space is post evaluation.
I have 2 different data frame, one is of 5.5 MB and the other is 25 GB. I want to check if these two data frame have the same value in 2 different columns for each row.
For e.g.
x 0 0 a
x 1 2 b
y 1 2 c
z 3 4 d
and
x 0 0 w
x 1 2 m
y 5 6 p
z 8 9 q
I want to check if the 2° and 3° column are equal for each row, if yes I return the 4° columns for the both data frame.Then I should have:
a w
b m
c m
the 2 data frame are sorted respect the 2° and 3° column value. I try in R but the 2° file (25 GB) is too big. How can I obtain this new file in a "faster" (even some hours) way ???
With GNU awk for arrays of arrays:
$ cat tst.awk
NR==FNR { a[$2,$3][$4]; next }
($2,$3) in a {
for (val in a[$2,$3]) {
print val, $4
}
}
$ awk -f tst.awk small_file large_file
a w
b m
c m
and with any awk (a bit less efficiently):
$ cat tst.awk
NR==FNR { a[$2,$3] = a[$2,$3] FS $4; next }
($2,$3) in a {
split(a[$2,$3],vals)
for (i in vals) {
print vals[i], $4
}
}
$ awk -f tst.awk small_file large_file
a w
b m
c m
The above when reading small_file (NR==FNR is only true for the first file read - look up those variables in the awk man page or google) creates an associative array a[] that maps an index created from the concatenation of the 2nd+3rd fields to the list of value of the 4th field for those 2nd/3rd field combinations. Then when reading large_file it looks up that array for the current 2nd/3rd field combination and loops through all of the values stored for that combination in the previous phase printing that value (the $4 from small_file) plus the current $4.
You said your small file is 5.5 MB and the large file is 25 GB. Since 1 MB is about 1,047,600 characters (see https://www.computerhope.com/issues/chspace.htm) and each of your lines is about 8 characters long that means your small file is about 130 thousand lines long and your large one about 134 million lines long so I expect on an average powered computer the above should take no more than a minute or 2 to run, it certainly won't take anything like an hour!
An alternative to the solution of Ed Morton, but with an identical idea:
$ cat tst.awk
NR==FNR { a[$2,$3] = a[$2,$3] $4 ORS; next }
($2,$3) in a {
s=a[$2,$3]; gsub(ORS,OFS $4 ORS,s)
printf "%s",s;
}
$ awk -f tst.awk small_file large_file
a w
b m
c m
I have two files, file A may be in file B and I would like to count for each line in file A, how many times it occurs in file B. For example:
File A:
GAGGACAGACTACTAAAGCC
CTTGCCGCAGATTATCAGAG
CCAGCTTGATGTGTCCTGTG
TGATAGGCAGTGGAACACTG
File B:
NTCTTGAGGAAAGGACGAATCTGCGGAGGACAGACTACTAAAGCCGTTTGAGAGCTAGAACGAGCAAGTTAAGAGA
TCTTGAGGAAAGGACGAAACTCCGGAGGACAGACTACTAAAGCCGTTTTAGAGCTAGAAAGCGCAAGTTAAACGAC
NTCTTGAGGAAAGGACGAATCTGCGCTTGCCGCAGATTATCAGAGGTATGAGAGCTAGAACGAGCAAGTTAAGAGC
TCTTGAGGAAAGGACGAAAGTGCGCTTGCCGCAGATTATCAGAGGTTTTAGAGCTAGAAAGAGCAAGTTAAAATAA
GATCTAGTGGAAAGGACGATTCTCCGCTTGCCGCAGATTATCAGAGGTTGTAGAGCTAGAACTAGCAAGTGACAAG
ATCTTGAGGAAAGGACGAATCTGCGCTTGCCGCAGATTATCAGAGGTTTGAGAGCTAGAACTAGCAAGTTAATAGA
CGATCAAGTGGAAGGACGATTCTCCGTGATAGGCAGTGGAACACTGGATGTAGAGCTAGAAATAGCAAGTGAGCAG
ATCTAGAGGAAAGGACGAATCTCCGTGATAGGCAGTGGAACACTGGTATGAGAGCTAGAACTAGCAAGTTAATAGA
TCTTGAGGAAAGGACGAAACTCCGTGATAGGCAGTGGAACACTGGTTTTAGAGCTAGAAAGCGCAAGTTAAAAGAC
And the output should be File C:
2 GAGGACAGACTACTAAAGCC
4 CTTGCCGCAGATTATCAGAG
0 CCAGCTTGATGTGTCCTGTG
3 TGATAGGCAGTGGAACACTG
I would like to do this using grep and I've tried a few variations of -c,o,f but I can't seem to get the right output.
How can I achieve this?
Try this
for i in `cat a`; do echo "$i `grep $i -c b`"; done
In this case if line from file A occurred several times in one line of file B then this will be count as one occurrence. If you want to count such occurrences but without its overlapping use this
for i in `cat a`; do printf $i; grep $i -o b | wc -l; done
And maybe this variant would be quicker
cat b | grep "`cat a`" -o | sort | uniq -c
#!/usr/bin/perl
open A, "A"; # open file "A" to handle A
open B, "B"; # open file "B" to handle B
chomp(#keys = <A>); # read keys to array, strip line-feeds
#counts{#keys} = (0) x #keys; # initialize hash counts for keys
while(<B>){ # iterate file handle B line by line
foreach $k (#keys){ # iterate keys array
if (/$k/) { # if key matches line
$counts{$k}++; # increase count for key by one
}
}
}
print "$counts{$_} $_\n" for (keys %counts);
Linux command to compare files:
comm FileA FileB
comm produces three-column output. Column one contains lines unique to FileA, column two contains lines unique to FileB, and column three contains lines common to both files.
This question already has an answer here:
Use awk to sum or average for each unique ID
(1 answer)
Closed 6 years ago.
I have a file that contains several comma-separated columns, including a customer ID in the first column.
One customer ID may occur on several rows, but always refers to the same real customer.
How do I run basic calculations in a shell script based on this ID column? For example, calculating the sum of the mileages (the 5th field) for the given customer ID.
102,305,Jin,Kerala,40
104,308,Paul,US,45
105,350,Nina,AUS,50
102,390,Jin,Kerala,10
104,395,Paul,US,35
102,399,Jin,Kerala,35
5th field is the mileage, 1st field is the customer ID.
This is a simple awk script that will sum up the mileages and print the customer IDs together with the sums at the end:
#!/usr/bin/awk -f
BEGIN { FS = "," }
{
customer_id = $1;
mileage = $5;
total_mileage[customer_id] += mileage;
}
END {
for (customer_id in total_mileage) {
print customer_id, total_mileage[customer_id];
}
}
To run (after making it executable with chmod +x script.awk):
$ ./script.awk data.in
102 85
104 80
105 50
Alternatively, as a "one-liner":
$ awk -F, '{t[$1]+=$5} END {for (c in t){print c,t[c]}}' data.in
102 85
104 80
105 50
While I agree with #wilx that using a database might be smarter, this sample awk script should get you started:
awk -v FS=',' '{miles[$1] += $5}
END { for (customerid in miles) {
print customerid, miles[customerid]; } }' customers
You can get a list of unique IDs using something like (assuming the first column is the ID):
awk '{print $1}' inputFile | sort -u
This outputs the first field of every single line in the input file inputFile, sorts them and removes duplicates.
You can then use that method with a bash loop to process each of the unique IDs with another awk command to perform some action on them. In the following snippet, I print out the matching lines for each ID:
for id in $(awk '{print $1}' inputFile | sort -u) ; do
echo "${id}:"
awk -vid=${id} '$1==id {print " "$0)' inputFile
done
In that code, for each individual ID, it first outputs the ID then uses awk to only process lines matching that ID. The action carried out is to output the full line with indentation.
Of course, you can do anything you wish with the lines matching each ID. As shown below, an example more closely matching your requirements.
First, here's an input file I used for testing - we can assume field 1 is the customer ID and field 2 the mileage:
$ cat inputFile
a 1
b 2
c 3
a 4
b 5
c 6
a 7
b 8
c 9
b 10
c 11
c 12
And here's a command-line transcript of the method proposed (note that $ and + are input prompt and continuation prompt respectively, they are not part of the actual commands):
$ for id in $(awk '{print $1}' inputFile | sort -u) ; do
+ awk -vid=${id} '
+ $1==id {print $0; sum += $2 }
+ END {print "Total: "sum; print }
+ ' inputFile
+ done
a 1
a 4
a 7
Total: 12
b 2
b 5
b 8
b 10
Total: 25
c 3
c 6
c 9
c 11
c 12
Total: 41
Keep in mind that, for non-huge data sets, it's also possible to do this in a single pass awk script, using associative arrays to store the totals then outputting all the data in the END block. I myself tend to prefer the multi-pass approach myself since it minimises the possibility of running out of memory. The trade-off, of course, is that it will no doubt take longer since you're processing the file more than once.
For a single-pass solution, you can use something like:
$ awk '{sum[$1] += $2} {for (key in sum) { print key": "sum[key]}}' inputFile
which gives you:
a: 12
b: 25
c: 41
I needed to extract all hits from one list (list.txt) which can be found in one of the columns of another (here in Data.txt) into a third (output.txt).
Data.txt (tab delimited)
some_data more_data other_data here yet_more_data etc
A B 2 Gee;Whiz;Hello 13 12
A B 2 Gee;Whizz;Hi 56 32
E 4 Btm;Lol 16 2
T 3 Whizz 13 3
List.txt
Gee
Whiz
Lol
Ideally output.txt looks like
some_data more_data other_data here yet_more_data etc
A B 2 Gee;Whiz;Hello 13 12
A B 2 Gee;Whizz;Hi 56 32
E 4 Btm;Lol 16 2
So I tried a shell script
for ids in List.txt
do
grep $ids Data.txt >> output.txt
done
except I typed out everything (cut and paste actually) in List.txt in said script.
Unfortunately it gave me an output.txt including the last line, I assume as 'Whizz' contains 'Whiz'.
I also tried cat Data.txt | egrep -F "List.txt" and that resulted in grep: conflicting matchers specified -- I suppose that was too naive of me. The actual files: List.txt contains a sorted list of 985 words, Data.txt has 115576 rows with 17 columns.
Some help/guidance would be much appreciated thanks.
Try something like this:
for ids in List.txt
do
grep "[TAB;]$ids[TAB;]" Data.txt >> output.txt
done
But it has two drawbacks:
"Data.txt" is scanned multiple times
You can get one line multiple times.
If it is problem try two step version:
cat List.txt | sed -e "s/.*/[TAB;]\0[TAB;]/g" > List_mod.txt
grep -f List_mod.txt Data.txt > output.txt
Note:
TAB character can be inserted by combination Ctrl-V following by Tab key in command line, and Tab character in editor. You have to check if your edit does not change tab to series of spaces.
The UNIX tool for general text processing is "awk":
awk '
NR==FNR { list[$0]; next }
{
for (word in list) {
if ($0 ~ "[\t;]" word "[\t;]") {
print
next
}
}
}
' List.txt Data.txt > output.txt