How to grep for all-but-one matching columns in R - r

I am trying to subset a large data frame with my columns of interest. I do so using the grep function, this selects one column too many ("has_socio"), which I would like to remove.
The following code does exactly what I want, but I find it unpleasant to look at. I want to do it in one line. Aside from just calling the first subset inside the second subset, can it be optimized?
DF <- read.dta("./big.dta")
DF0 <- na.omit(subset(DF, select=c(other_named_vars, grep("has_",names(DF)))))
DF0 <- na.omit(subset(DF0, select=-c(has_socio)))
I know similar questions have been asked (e.g. Subsetting a dataframe in R by multiple conditions) but I do not find one that addresses this issue specifically. I recognize I could just write the grep RE more carefully, but I feel the above code more clearly expresses my intent.
Thanks.

Replace your grep with:
vec <- c("blah", "has_bacon", "has_ham", "has_socio")
grep("^has_(?!socio$)", vec, value=T, perl=T)
# [1] "has_bacon" "has_ham"
(?!...) is a negative lookahead operator, which looks ahead and makes sure that its contents do not follow the actual matching piece behind of it (has_ being the matching piece).

setdiff(grep("has_", vec, value = TRUE), "has_socio")
## [1] "has_bacon" "has_ham"

Related

Stringr str_which first compare 1st row with whole column than to next row

I am trying to match DNA sequences in a column. I am trying to find the longer version of itself, but also in this column it has the same sequence.
I am trying to use Str_which for which I know it works, since if I manually put the search pattern in it finds the rows which include the sequence.
As a preview of the data I have:
SNID type seqs2
9584818 seqs TCTTTCTTTAAGACACTGTCCCAAGCTGAAAGGGAACCTACCAAAGAAACTTCTTCATCTRAGGAATCTACTTATATGTGAGTGCAATGAACTTGTAGATTCTGCTCCTGGGGCCACAGAA
9584818 reversed TTCTGTGGCCCCAGGAGCAGAATCTACAAGTTCATTGCACTCACATATAAGTAGATTCCTYAGATGAAGAAGTTTCTTTGGTAGGTTCCCTTTCAGCTTGGGACAGTGTCTTAAAGAAAGA
9562505 seqs GTCTTCAGCATCTTTCTTTAAGACACTGTCCCAAGCTGAAAGGGAACCTACCAAAGAAACTTCTTCATCTRAGGAATCTACTTATATGTGAGTGCAATGAACTTGTAGATTCTGCTCCTGGGGCCACAGAACTTTGTGAAT
9562505 reversed ATTCACAAAGTTCTGTGGCCCCAGGAGCAGAATCTACAAGTTCATTGCACTCACATATAAGTAGATTCCTYAGATGAAGAAGTTTCTTTGGTAGGTTCCCTTTCAGCTTGGGACAGTGTCTTAAAGAAAGATGCTGAAGAC
Using a simple search of row one as x
x <- "TCTTTCTTTAAGACACTGTCCCAAGCTGAAAGGGAACCTACCAAAGAAACTTCTTCATCTRAGGAATCTACTTATATGTGAGTGCAATGAACTTGTAGATTCTGCTCCTGGGGCCACAGAA"
str_which(df$seqs2, x)
I get the answer I expect:
> str_which(df$seqs3, x)
[1] 1 3
But when I try to search as a whole column, I just get the result of the rows finding itself. And not the other rows in which it is also stated.
> str_which(df$seqs2, df$seqs2)
[1] 1 2 3 4
Since my data set is quite large, I do not want to do this manually, and rather use the column as input, and not just state "x" first.
Anybody any idea how to solve this? I have tried most Stringr cmds by now, but by mistake I might have did it wrongly or skipped some important ones.
Thanks in advance
You may need lapply :
lapply(df$seqs2, function(x) stringr::str_which(df$seqs2, x))
You can also use grep to keep this in base R :
lapply(df$seqs2, function(x) grep(x, df$seqs2))

How to match any character existing between a pattern and a semicolon

I am trying to get anything existing between sample_id= and ; in a vector like this:
sample_id=10221108;gender=male
tissue_id=23;sample_id=321108;gender=male
treatment=no;tissue_id=98;sample_id=22
My desired output would be:
10221108
321108
22
How can I get this?
I've been trying several things like this, but I don't find the way to do it correctly:
clinical_data$sample_id<-c(sapply(myvector, function(x) sub("subject_id=.;", "\\1", x)))
You could use sub with a capture group to isolate that which you are trying to match:
out <- sub("^.*\\bsample_id=(\\d+).*$", "\\1", x)
out
[1] "10221108" "321108" "22"
Data:
x <- c("sample_id=10221108;gender=male",
"tissue_id=23;sample_id=321108;gender=male",
"treatment=no;tissue_id=98;sample_id=22")
Note that the actual output above is character, not numeric. But, you may easily convert using as.numeric if you need to do that.
Edit:
If you are unsure that the sample IDs would always be just digits, here is another version you may use to capture any content following sample_id:
out <- sub("^.*\\bsample_id=([^;]+).*$", "\\1", x)
out
You could try the str_extract method which utilizes the Stringr package.
If your data is separated by line, you can do:
str_extract("(?<=\\bsample_id=)([:digit:]+)") #this tells the extraction to target anything that is proceeded by a sample_id= and is a series of digits, the + captures all of the digits
This would extract just the numbers per line, if your data is all collected like that, it becomes a tad more difficult because you will have to tell the extraction to continue even if it has extracted something. The code would look something like this:
str_extract_all("((?<=sample_id=)\\d+)")
This code will extract all of the numbers you're looking for and the output will be a list. From there you can manipulate the list as you see fit.

How to use one on one grep between 2 columns of a data frame in R

I have a dataframe X with 2 columns named "pattern" and "text" in R.
I want to search each pattern within the corresponding text.
For this I am using the grepl command. However, grepl is working fine only in the following scenario where it finds one pattern and tests against each row of the dataframe column:
grepl("findthis",X$text)
However, when I do the following, it only checks the first record of the first column one by one against all records of the second column.
grepl(X$pattern,X$text)
I am looking for a function which would take the first record of X$pattern and check it in the first record of X$text, then take the 2nd record of X$pattern and check it in the second record of X$test.
Is this possible through some library function?
Edit: The solution given by #akrun works as per my requirement.However, I am using a series of grepl commands in a nested ifelse. Simply put it is something like the code below (but with more nesting):
X$result = ifelse(grepl(X$pattern,X$text),1,ifelse(grepl("abc",X$email),2,3)
How do I solve for this?
One option is Map/mapply
unname(mapply(grepl, X$pattern, X$text))
#[1] TRUE FALSE
data
X <- data.frame(text = c("find this text", "Something else"),
pattern = c("find this", "find that"), stringsAsFactors=FALSE)

R Grep Function - working with the outcome matches to fill a column

I am trying to come with a solution for using grep function to a column of data and filling the grep matches with a number 1 and fill the mismatches with O´s but I just can´t come up with a solution (I am totally new to R, so what I am doing is probably going to make some folks lol).
info <- cbind(info, A_DO = ifelse(grep("DO",info[,"ACTUAL"])>0,1,0)
The info table looks like this:(I´ve included the last column as that is my desired ouput)
PLAZA_CR|TZ|LOCATION|FA|TIPO_REPARTO|ACTUAL|NUEVO|**A_DO**
10GTO|8|19973|3633|DIURNO|DO|MI|**1**
10GTO|8|19975|10198|DIURNO|LUJU|DO|**0**
10GTO|8|1237|3633|DIURNO|DO|LUJU|**1**
10GTO|8|20204|3633|DIURNO|DOMAJU|LUMIJU|**1**
10GTO|8|1108|3633|DIURNO|LUMIJU|DOMAJU|**0**
10GTO|8|10895|368|DIURNO|DO|DOMIVI|**1**
10GTO|8|9434|3634|DIURNO|DOMIVI|DO|**1**
10GTO|8|17403|3633|DIURNO|DOLUMAMIJUVI|MAVI|**1**
10GTO|8|17404|3633|DIURNO|MAVI|DOLUMAMIJUVI|**0**
10GTO|8|2585|368|DIURNO|LUJU|DOMIVI|**0**
10GTO|8|16927|3634|DIURNO|DOMIVI|LUJU|**1**
Similar to as NiCE commented, you can use something like this, taking the output of grepl, which returns a logical vector for the matches:
info$A_DO <- as.numeric(grepl("DO", info[ , "ACTUAL"]))
So you don't need to use the cbind, as you can use the $ operator to create a new column of info, but you can use it if you'd prefer:
info <- cbind(info, A_DO = as.numeric(grepl("DO", info[ , "ACTUAL"])))

Processing files in a particular order in R

I have several datafiles, which I need to process in a particular order. The pattern of the names of the files is, e.g. "Ad_10170_75_79.txt".
Currently they are sorted according to the first numbers (which differ in length), see below:
f <- as.matrix (list.files())
f
[1] "Ad_10170_75_79.txt" "Ad_10345_76_79.txt" "Ad_1049_25_79.txt" "Ad_10531_77_79.txt"
But I need them to be sorted by the middle number, like this:
> f
[1] "Ad_1049_25_79.txt" "Ad_10170_75_79.txt" "Ad_10345_76_79.txt" "Ad_10531_77_79.txt"
As I just need the middle number of the filename, I thought the easiest way is, to get rid of the rest of the name and renaming all files. For this I tried using strsplit (plyr).
f2 <- strsplit (f,"_79.txt")
But I'm sure there is a way to sort the files directly, without renaming all files. I tried using sort and to describe the name with regex but without success. This has been a problem for many days, and I spent several hours searching and trying, to solve this presumably easy task. Any help is very much appreciated.
old example dataset:
f <- c("Ad_10170_75_79.txt", "Ad_10345_76_79.txt",
"Ad_1049_25_79.txt", "Ad_10531_77_79.txt")
Thank your for your answers. I think I have to modify my example, because the solution should work for all possible middle numbers, independent of their digits.
new example dataset:
f <- c("Ad_10170_75_79.txt", "Ad_10345_76_79.txt",
"Ad_1049_9_79.txt", "Ad_10531_77_79.txt")
Here's a regex approach.
f[order(as.numeric(gsub('Ad_\\d+_(\\d+)_\\d+\\.txt', '\\1', f)))]
# [1] "Ad_1049_9_79.txt" "Ad_10170_75_79.txt" "Ad_10345_76_79.txt" "Ad_10531_77_79.txt"
Try this:
f[order(as.numeric(unlist(lapply(strsplit(f, "_"), "[[", 3))))]
[1] "Ad_1049_25_79.txt" "Ad_10170_75_79.txt" "Ad_10345_76_79.txt" "Ad_10531_77_79.txt"
First we split by _, then select the third element of every list element, find the order and subset f based on that order.
I would create a small dataframe containing filenames and their respective extracted indices:
f<- c("Ad_10170_75_79.txt","Ad_10345_76_79.txt","Ad_1049_25_79.txt","Ad_10531_77_79.txt")
f2 <- strsplit (f,"_79.txt")
mydb <- as.data.frame(cbind(f,substr(f2,start=nchar(f2)-1,nchar(f2))))
names(mydb) <- c("filename","index")
library(plyr)
arrange(mydb,index)
Take the first column of this as your filename vector.
ADDENDUM:
If a numeric index is required, simply convert character to numeric:
mydb$index <- as.numeric(mydb$index)

Resources