skipping recursion - recursion

The first line is a number, int x. The following m lines contain letters. After m lines, you read in a number, int y.
The goal is to find the soluiton number, int y, from recursion of 1 letter from each line.
The problem states that there’s a much faster solution which avoids going through each possible password. That is where my question is. How can this be done? Any help would be greatly appreciated.

This is not that complicated. You can count the number of letters in the m lines. Then you calculate a value for every line of letters, that specifies how many possible solutions are skipped, if one letter in the referenced line is skipped. Visualized:
abc -> 3 letters
xy -> 2 letters
dmnr -> 4 letters
if you skip from the n-th letter to the n+1-th letter in the "abc" line, you skip as many possible solutions as the product of the length of every following line says. so you skip 2*4 solutions -> 8 solutions.
repeat this step for xy -> 4 solutions skipped.
the last line skips alwasy 1 solution, because it is the recursion path itself.
so now you know, how many solutions you skip, if you skip to some specific letter. the last thing is simple. you start with 1 and add the calculated value of each line to the number, until it reaches exactly r.
means in c++:
int v = 1, r=10;
int i1=0, i2=0, i3=0;
while (v<=r-8) {
i1++;
v+=8;
}
while (v<=r-4) {
i2++;
v+=4;
}
while (v<=r-1) {
i3++;
v++;
}
now i1 is the index of the letter you need to use from the "abc" line, i2 is the index of the letter from "xy" and i3 from "dmnr" :) thats all. the algorithm should end with i1=1, i2=0, i3=1 -> "b" + "x" + "m"
I hope this helps. It removes the recursion, but that's no problem, is it? ;)

Related

Differences in result in two similar functions: finding the key with maximun value

I am currently having an issue. Basically, I have 2 similar functions in terms of concept but the results do not align. These are the codes I learned from Bioinformatics I on Coursera.
The first code is simply creating a dictionary of occurrences of each k-mer pattern from a text (which is a long stretch of nucleotides). In this case, k is 5.
def FrequencyMap(text,k):
freq ={}
for i in range (0, len(text)-k+1):
freq[text[i:i+k]]=0
for j in range (0, len(text)-k+1):
if text[j:j+k] == text[i:i+k]:
freq[text[i:i+k]] +=1
return freq, max(freq)
The text and the result dictionary are kinda long, but the main point is when I call max(freq), it returns the key 'TTTTC', which has a value of 1.
Meanwhile, I wrote another code that is simply based on the previous code to generate the 5-mer patterns that have the max values (number of occurrences in the text).
def FrequentWords(text, k):
a = FrequencyMap(text, k)
m = max(a.values())
words = []
for i in a:
if a[i]==m:
words.append(i)
return words,m
And this code returns 'ACCTA', which has the value of 99, meaning it appears 99 times in the text. This makes total sense.
I used the same text and k (k=5) for both codes. I ran the codes on Jupyter Notebook. Why does the first one not return 'ACCTA'?
Thank you so much,
Here is the text, if anyone wants to try:
"ACCATCCCTAGGGCATACCTAAGTCTACCTAAAAGGCTACCTAATACCATACCTAATTACCTAACTACCTAAAATAAGTCTACCTAATACCTAATACCTAAAGTTACCTAACGTACCTAATACCTAATACCTAACCACTACCTAATCCGATTTACCTAACAACCGATCGAGTACCTAATCGATACCTAAATAACGGACAATATACCTAATTACCTAATACCTAATACCTAAGTGTACCTAAGACGTCTACCTAATTGTACCTAACTACCTAATTACCTAAGATTAATACCTAATACCTAATTTACCTAATACCTAACGTGGACTACCTAATACCTAACTTTTCCCCTACCTAATACCTAACTGTACCTAAATACCTAATACCTAAGCTACCTAAAGAACAACATTGTACGTGCGCCGTACCTAAATACCTAACAACTACCTAACTGATACCTAATAGTGATTACCTAACGCTTCTACCTAACTACCTAAGTACCTAACGCTACCTAACTACCTAATGTCCACAAAATACCTAATACCTAATAGCTACCTAATTGTGTACCTAAGTACCTAACCTACCTAATAATACCTAAAAATACCTAAGTACCTAACGTACCTAAATTTTACCTAATCTACCTAACGTACCTAATACCTAATTATACCTAATTACCTAATGGTTACCTAAGTTACCTAATATGCCACTACCTAACCTTACCTAAGACCTACCTAATAGGTACCTAACTGGGTACCTAAGGCAGTTTACCTAATTCAGGGCTACCTAATGTACCTAATACCTAAGTACCTAATACCTAATCCCATACCTAATATTTACCTAAGGGCACCGGTACCTAATACCTAATACCTAATACCTAAACCTTCGTACCTAAATACCTAATCTACCTAATGTACCTAAGGTACCTAATACCTAAGTCACTACCTAATACCTAATACCTAATGGGAGGAGCTTACCTAAGGTTACCTAATTACCTAAATACCTAATCGTTACCTAA"
Why does the first one not return 'ACCTA'?
Because max(freq) returns the maximum key of the dictionary. In this case the keys are strings (the k-mers), and strings are compared alphabetically. Hence the maximum one is the last string when the are sorted alphabetically.
If you want the first function to return the k-mer that occurs most often, you should change max(freq) to max(freq.items(), key=lambda key_value_pair: key_value_pair[1])[0]. Here, you are sorting the (kmer, count) pairs (that's the key_value_pair parameter of the lambda expression) based on the frequency and then selecting the kmer.

How would I convert numbers to their decimal representation?

I am not sure how to approach it but could someone help me convert the following numbers to their decimal representation:
and
The general method goes something like this:
Work from right to left, you'll want to count the positions (starting with zero) and sum up the terms according to a the following formula:
Say you're working in base x. Then, if you're at the ith position, and that digit is d, then that position will contribute a term of d times x^i to the final sum.
As a concrete example, take your first number - here, x=7 (the base). Starting from the right, the first digit is d=6 at the i=0 position. So we start with 6*(7^0) = 6(1) = 6.
Moving to the left, i=1 and d=5. So we get 5(7^1) = 5(7) = 35 for this term.
Then, moving to the last digit, i=2 and d=4. So we get 4*(7^2)=4(49)=196 for the last term.
Now, you can just add all of these up to get 35 + 6 + 196 = 237 as your final number (in base 10, that is).
The exact same algorithm works for any base, so you should be able to apply it to the binary number in the exact same way.
(Just let x=2 and work right to left, noting that i ranges from 0 to 7 here.)

Completing a list of possible binary sequences give a binary sequence with gaps

So, I am working on a program in Scilab which solves a binary puzzle. I have come across a problem however. Can anyone explain to me the logic behind solving a binary sequence with gaps (like [1 0 -1 0 -1 1 -1] where -1 means an empty cell. I want all possible solutions of a given sequence. So far I have:
function P = mogelijkeCombos(V)
for i=1:size(V,1)
if(V(i) == -1)
aantalleeg = aantalleeg +1
end
end
for i=1:2^aantalleeg
//creating combos here
end
endfunction
sorry that some words are in dutch
aantalleeg means amountempty by which I mean the amount of empty cells
I hope I gave you guys enough info. I don't need any code written, I'd just like ideas of how I can make every possible rendition as I am completely stuck atm.
BTW this is a school assignment, but the assignment is way bigger than this and it's just a tiny part I need some ideas on
ty in advance
Short answer
You could create the combos by extending your code and create all possible binary words of the length "amountempty" and replacing them bit-for-bit in the empty cells of V.
Step-by-step description
Find all the empty cell positions
Count the number of positions you've found (which equals the number of empty cells)
Create all possible binary numbers with the length of your count
For each binary number you generate, place the bits in the empty cells
print out / store the possible sequence with the filled in bits
Example
Find all the empty cell positions
You could for example check from left-to-right starting at 1 and if a cell is empty add the position to your position list.
V = [1 0 -1 0 -1 1 -1]
^ ^ ^
| | |
1 2 3 4 5 6 7
// result
positions = [3 5 7]
Count the number of positions you've found
//result
amountempty = 3;
Create all possible binary numbers with the length amountempty
You could create all possible numbers or words with the dec2bin function in SciLab. The number of possible words is easy to determine because you know how much separate values can be represented by a word of amountempty bits long.
// Create the binary word of amountEmpty bits long
binaryWord = dec2bin( i, amountEmpty );
The binaryWord generated will be a string, you will have to split it into separate bits and convert it to numbers.
For each binaryWord you generate
Now create a possible solution by starting with the original V and fill in every empty cell at the position from your position list with a bit from binaryWordPerBit
possibleSequence = V;
for j=1:amountEmpty
possibleSequence( positions(j) ) = binaryWordPerBit(j);
end
I wish you "veel succes met je opdracht"

Probability of 3-character string appearing in a randomly generated password

If you have a randomly generated password, consisting of only alphanumeric characters, of length 12, and the comparison is case insensitive (i.e. 'A' == 'a'), what is the probability that one specific string of length 3 (e.g. 'ABC') will appear in that password?
I know the number of total possible combinations is (26+10)^12, but beyond that, I'm a little lost. An explanation of the math would also be most helpful.
The string "abc" can appear in the first position, making the string look like this:
abcXXXXXXXXX
...where the X's can be any letter or number. There are (26 + 10)^9 such strings.
It can appear in the second position, making the string look like:
XabcXXXXXXXX
And there are (26 + 10)^9 such strings also.
Since "abc" can appear at anywhere from the first through 10th positions, there are 10*36^9 such strings.
But this overcounts, because it counts (for instance) strings like this twice:
abcXXXabcXXX
So we need to count all of the strings like this and subtract them off of our total.
Since there are 6 X's in this pattern, there are 36^6 strings that match this pattern.
I get 7+6+5+4+3+2+1 = 28 patterns like this. (If the first "abc" is at the beginning, the second can be in any of 7 places. If the first "abc" is in the second place, the second can be in any of 6 places. And so on.)
So subtract off 28*36^6.
...but that subtracts off too much, because it subtracted off strings like this three times instead of just once:
abcXabcXabcX
So we have to add back in the strings like this, twice. I get 4+3+2+1 + 3+2+1 + 2+1 + 1 = 20 of these patterns, meaning we have to add back in 2*20*(36^3).
But that math counted this string four times:
abcabcabcabc
...so we have to subtract off 3.
Final answer:
10*36^9 - 28*36^6 + 2*20*(36^3) - 3
Divide that by 36^12 to get your probability.
See also the Inclusion-Exclusion Principle. And let me know if I made an error in my counting.
If A is not equal to C, the probability P(n) of ABC occuring in a string of length n (assuming every alphanumeric symbol is equally likely) is
P(n)=P(n-1)+P(3)[1-P(n-3)]
where
P(0)=P(1)=P(2)=0 and P(3)=1/(36)^3
To expand on Paul R's answer. Probability (for equally likely outcomes) is the number of possible outcomes of your event divided by the total number of possible outcomes.
There are 10 possible places where a string of length 3 can be found in a string of length 12. And there are 9 more spots that can be filled with any other alphanumeric characters, which leads to 36^9 possibilities. So the number of possible outcomes of your event is 10 * 36^9.
Divide that by your total number of outcomes 36^12. And your answer is 10 * 36^-3 = 0.000214
EDIT: This is not completely correct. In this solution, some cases are double counted. However they only form a very small contribution to the probability so this answer is still correct up to 11 decimal places. If you want the full answer, see Nemo's answer.

A way of checking if the digits of num1 are the digits in num2 without checking each digit?

Lets say I have guessed a lottery number of:
1689
And the way the lottery works is, the order of the digits don't matter as long as the digits match up 1:1 with the digits in the actual winning lottery number.
So, the number 1689 would be a winning lottery number with:
1896, 1698, 9816, etc..
As long as each digit in your guess was present in the target number, then you win the lottery.
Is there a mathematical way I can do this?
I've solved this problem with a O(N^2) looping checking each digit against each digit of the winning lottery number (separating them with modulus). Which is fine, it works but I want to know if there are any neat math tricks I can do.
For example, at first... I thought I could be tricky and just take the sum and product of each digit in both numbers and if they matched then you won.
^ Do you think that would work?
However, I quickly disproved this when I found that lottery guess: 222, and 124 have the different digits but the same product and sum.
Anyone know any math tricks I can use to quickly determine if the digits in num1 match the digits in num2 regardless of order?
How about going through each number, and counting up the number of appearances of each digit (into two different 10 element arrays)? After you'd done the totaling, compare the counts of each digit. Since you only look at each digit once, that's O(N).
Code would look something like:
for(int i=0; i<digit_count; i++)
{
guessCounts[guessDigits[i] - '0']++;
actualCounts[actualDigits[i] - '0']++;
}
bool winner = true;
for(int i=0; i<10 && winner; i++)
{
winner &= guessCounts[i] == actualCounts[i];
}
Above code makes the assumption that guessDigits and actualDigits are both char strings; if they held the actual digits then you can just skip the - '0' business.
There are probably optimizations that would make this take less space or terminate sooner, but it's a pretty straightforward example of an O(N) approach.
By the way, as I mentioned in a comment, the multiplication/sum comparison will definitely not work because of zeros. Consider 0123 and 0222. Product is 0, sum is 6 in both cases.
Split into array, sort array, join into string, compare strings.
(Not a math trick, I know)
You can place the digits into an array, sort the array, then compare the arrays element by element. This will give you O( NlogN ) complexity which is better than O( N^2 ).
If N can become large, sorting the digits is the answer.
Because digits are 0..9 you can count the number of occurrences of each digit of the lottery answer in an array [0..9].
To compare you can subtract 1 for each digit you encounter in the guess. When you encounter a digit where the count is already 0, you know the guess is different. When you get through all the digits, the guess is the same (as long as the guess has as many digits as the lottery answer).
For each digit d multiply with the (d+1)-th prime number.
This is more mathematical but less efficient than the sorting or bucket methods. Actually it is the bucket method in disguise.
I'd sort both number's digits and compare them.
If you are only dealing with 4 digits I dont think you have to put much thought into which algorithm you use. They will all perform roughly the same.
Also 222 and 124 dont have the same sum
You have to consider that when n is small, the order of efficiency is irrelevant, and the constants start to matter more. How big can your numbers actually get? Can you get up to 10 digits? 20? 100? If your numbers have just a few digits, n^2 really isn't that bad. If you have strings of thousands of digits, then you might actually need to do something more clever like sorting or bucketing. (i.e. count the 0s, count the 1s, etc.)
I'm stealing the answer from Yuliy, and starblue (upvote them)
Bucketing is the fastest aside from the O(1)
lottonumbers == mynumbers;
Sorting is O(nlog2n)
Bucketsort is an O(n) algorithm.
So all you need to do is do it twice (once for your numbers, once for the target-set), and if the numbers of the digits add up, then they match.
Any kind of sorting is an added overhead that is unnecessary in this case.
array[10] digits;
while(targetnum > 0)
{
short currDig = targetnum % 10;
digits[currDig]++;
targetnum = targetnum / 10;
}
while(mynum > 0)
{
short myDig = mynum % 10;
digits[myDig]--;
mynum = mynum / 10;
}
for(int i = 0; i < 10; i++)
{
if(digits[i] == 0)
continue;
else
//FAIL TO MATCH
}
Not the prettiest code, I'll admit.
Create an array of 10 integers subscripted [0 .. 9].
Initialize each element to a different prime number
Set product to 1.
Use each digit from the number, to subscript into the array,
pull out the prime number, and multiply the product by it.
That gives you a unique representation which is digit order independent.
Do the same procedure for the other number.
If the unique representations match, then the original numbers match.
If there are no repeating digits allowed (not sure if this is the case though) then use a 10-bit binary number. The most significant bit represents the digit 9 and the LSB represents the digit 0. Work through each number in turn and flip the appropriate bit for each digit that you find
So 1689 would be: 1101000010
and 9816 would also be: 1101000010
then a XOR or a subtract will leave 0 if you are a winner
This is just a simple form of bucketing
Just for fun, and thinking outside of the normal, instead of sorting and other ways, do the deletion-thing. If resultstring is empty, you have a winner!
Dim ticket As String = "1324"
Dim WinningNumber As String = "4321"
For Each s As String In WinningNumber.ToCharArray
ticket = Replace(ticket, s, "", 1, 1)
Next
If ticket = "" Then MsgBox("WINNER!")
If ticket.Length=1 then msgbox "Close but no cigar!"
This works with repeating numbers too..
Sort digits before storing a number. After that, your numbers will be equal.
One cute solution is to use a variant of Zobrist hashing. (Yes, I know it's overkill, as well as probabilistic, but hey, it's "clever".)
Initialize a ten-element array a[0..9] to random integers. Then, for each number d[], compute the sum of a[d[i]]. If the numbers contained the same digits, the resulting numbers will be equal; with high probability (~ 1 in how many possible ints there are), the opposite is true as well.
(If you know that there will be at most 10 digits total, then you can use the fixed numbers 1, 10, 100, ... instead of random numbers for guaranteed success. This is bucket sorting in not-too-much disguise.)

Resources