read.table and files with excess commas - r
I am trying to import a CSV file into R using the read.table command. I keep getting the error message "more columns than column names", even though I have set the strip.white to TRUE. The program that makes the csv files adds a large number of comma characters to the end of each line, which I think is the source of the extra columns.
read.table("filename.csv", sep=",", fill=T, header=TRUE, strip.white = T,
as.is=T,row.names = NULL, quote = "")
How can I get R to strip away the extraneous columns of commas from the header line and from the rest of the CSV file as it reads it into the R console?
Also, numerous cells in the csv file do not contain any data. Is it possible to get R to fill in these empty cells with "NA"?
The first two lines of the csv file:
Document_Name,Sequence_Name,Track_Name,Type,Name,Sequence,Minimum,Min_(with_gaps),Maximum,Max_(with_gaps),Length,Length_(with_gaps),#_Intervals,Direction,Average_Quality,Coverage,modified_by,Polymorphism_Type,Strand-Bias,Strand-Bias_>50%_P-value,Strand-Bias_>65%_P-value,Variant_Frequency,Variant_Nucleotide(s),Variant_P-Value_(approximate),,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
Chr2_FT,Chr2,Chr2.bed,CDS,10000_ARHGAP15,GAAAGAATCATTAACAGTTAGAAGTTGATG-AAGTTTCAATAACAAGTGGGCACTGAGAGAAAG,55916421,56019336,55916483,56019399,63,64,1,forward,,,User,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
You can use a combination of colClasses with "NULL" entries to "blank-out" the commas (also still needing , fill=TRUE:
read.table(text="1,2,3,4,5,6,7,8,,,,,,,,,,,,,,,,,,
9,9,9,9,9,9,9,9,,,,,,,,,,,,,,,,,", sep=",", fill=TRUE, colClasses=c(rep("numeric", 8), rep("NULL", 30)) )
#------------------
V1 V2 V3 V4 V5 V6 V7 V8
1 1 2 3 4 5 6 7 8
2 9 9 9 9 9 9 9 9
Warning message:
In read.table(text = "1,2,3,4,5,6,7,8,,,,,,,,,,,,,,,,,,\n9,9,9,9,9,9,9,9,,,,,,,,,,,,,,,,,", :
cols = 26 != length(data) = 38
I needed to add back in the missing linefeed at the end of the first line. (Yet another reason why you should edit questions rather than putting data examples in the comments.) There was an octothorpe in the header which required the comment.char be set to "":
read.table(text="Document_Name,Sequence_Name,Track_Name,Type,Name,Sequence,Minimum,Min_(with_gaps),Maximum,Max_(with_gaps),Length,Length_(with_gaps),#_Intervals,Direction,Average_Quality,Coverage,modified_by,Polymorphism_Type,Strand-Bias,Strand-Bias_>50%_P-value,Strand-Bias_>65%_P-value,Variant_Frequency,Variant_Nucleotide(s),Variant_P-Value_(approximate),,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,\nChr2_FT,Chr2,Chr2.bed,CDS,10000_ARHGAP15,GAAAGAATCATTAACAGTTAGAAGTTGATG-AAGTTTCAATAACAAGTGGGCACTGAGAGAAAG,55916421,56019336,55916483,56019399,63,64,1,forward,,,User,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,", header=TRUE, colClasses=c(rep("character", 24), rep("NULL", 41)), comment.char="", sep=",")
Document_Name Sequence_Name Track_Name Type Name
1 Chr2_FT Chr2 Chr2.bed CDS 10000_ARHGAP15
Sequence Minimum Min_.with_gaps... Maximum
1 GAAAGAATCATTAACAGTTAGAAGTTGATG-AAGTTTCAATAACAAGTGGGCACTGAGAGAAAG 55916421 56019336 55916483
Max_.with_gaps. Length Length_.with_gaps. X._Intervals Direction Average.._Quality Coverage modified_by
1 56019399 63 64 1 forward User
Polymorphism_Type Strand.Bias Strand.Bias_.50._P.va..lue Strand.Bias_.65._P.value Variant_Frequency
1
Variant_Nucleotide.s. Variant_P.Va..lue_.approximate.
1
If you know what your colClasses will be, then you can get missing values to be NA in the numeric columns automatically. You could also use the na.strings setting to accomplish this. You could also do some editing on the header to take out the illegal characters in the column names. (I didn't think I needed to be the one to do that though.)
read.table(text="Document_Name,Sequence_Name,Track_Name,Type,Name,Sequence,Minimum,Min_(with_gaps),Maximum,Max_(with_gaps),Length,Length_(with_gaps),#_Intervals,Direction,Average_Quality,Coverage,modified_by,Polymorphism_Type,Strand-Bias,Strand-Bias_>50%_P-value,Strand-Bias_>65%_P-value,Variant_Frequency,Variant_Nucleotide(s),Variant_P-Value_(approximate),,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
Chr2_FT,Chr2,Chr2.bed,CDS,10000_ARHGAP15,GAAAGAATCATTAACAGTTAGAAGTTGATG-AAGTTTCAATAACAAGTGGGCACTGAGAGAAAG,55916421,56019336,55916483,56019399,63,64,1,forward,,,User,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,", header=TRUE, colClasses=c(rep("character", 24), rep("NULL", 41)), comment.char="", sep=",", na.strings="")
#------------------------------------------------------
Document_Name Sequence_Name Track_Name Type Name
1 Chr2_FT Chr2 Chr2.bed CDS 10000_ARHGAP15
Sequence Minimum Min_.with_gaps... Maximum
1 GAAAGAATCATTAACAGTTAGAAGTTGATG-AAGTTTCAATAACAAGTGGGCACTGAGAGAAAG 55916421 56019336 55916483
Max_.with_gaps. Length Length_.with_gaps. X._Intervals Direction Average.._Quality Coverage modified_by
1 56019399 63 64 1 forward <NA> <NA> User
Polymorphism_Type Strand.Bias Strand.Bias_.50._P.va..lue Strand.Bias_.65._P.value Variant_Frequency
1 <NA> <NA> <NA> <NA> <NA>
Variant_Nucleotide.s. Variant_P.Va..lue_.approximate.
1 <NA> <NA>
I have been fiddling with the first two lines of your file, and the problem appears to be the # in one of your column names. read.table treats # as a comment character by default, so it reads in your header, ignores everything after # and returns 13 columns.
You will be able to read in your file with read.table using the argument comment.char="".
Incidentally, this is yet another reason why those who ask questions should include examples of the files/datasets they are working with.
Related
R software, read.csv, multiple separators
Does anyone know a way to read a csv file in R with multiple separators? a<-read.csv("C:/Users/User/Desktop/file.csv", sep=",", header=FALSE) Here, I have the following dataset (txt/csv file) separated by commas and spaces: 5.006,84.698 4.604,87.725 7.250,88.392 6.668,91.556 5.927,95.440 4.953,99.695 7.387,100.489 6.466,104.447 5.599,107.548 4.053,111.411 7.440,112.892 6.096,116.417 4.805,119.031 7.546,120.671 6.149,123.793 4.307,127.201 7.461,129.974 5.493,132.853 7.641,135.393 and I want it to be read as a table with four columns, like this: 72 5.006 84.698 NA NA 73 4.604 87.725 7.250 88.392 74 6.668 91.556 NA NA 75 5.927 95.440 NA NA 76 4.953 99.695 7.387 100.489 77 6.466 104.447 NA NA 78 5.599 107.548 NA NA 79 4.053 111.411 7.440 112.892 80 6.096 116.417 NA NA 81 4.805 119.031 7.546 120.671 82 6.149 123.793 NA NA 83 4.307 127.201 7.461 129.974 84 5.493 132.853 7.641 135.393 Do you know the possible way to read it that way in R?
You could open the file in any text editor (notepad or something similar) and make the separators common across the file. You can either replace ',' with spaces or vice-versa using Find and Replace all and save the file. Once you do that you can use read.csv with this new separator. a <- read.csv("C:/Users/User/Desktop/file.csv", sep= " ", header=FALSE, fill = TRUE)
We can try using readLines() to read each line as a string. Then, we can split on multiple separators and roll up into a data frame. file <- "C:/Users/User/Desktop/file.csv" txt <- readLines(file, sep = "")) y <- strsplit(txt, "[, ]+") z <- lapply(y,function(x){as.data.frame(t(as.numeric(x)))}) df <- do.call(rbind.fill, z) df
One option is to use Excel. You can choose multiple separators (delimiters) during the import stage (Wizard step 2). Comma and space are one of the default choices but you can choose other characters too. Then import the excel file using one of many user-contributed packages, for example, readxl, or save as text and use read.csv / read.table.
When I read from a txt file it is returned as one column -R
I can't change the file I was given. Its extension is .txt, and every line looks like this: 00004 A009 1 Cholera, unspecified Cholera, unspecified When I try to read it with read.table, it returns only one column. How can I separate the 5 columns? (They have spaces between them, but when I use " " as sep, I get an error)
Data: I copy and pasted the your example data to a text file called tester.txt in an attempt to reproduce your error. The file contains nothing more than the following: 00004 A009 1 Cholera, unspecified Cholera, unspecified Read Table: I get the following with read.table: df <- read.table("tester.txt") > df V1 V2 V3 V4 V5 V6 V7 1 4 A009 1 Cholera, unspecified Cholera, unspecified The output here my not be delineated exactly as you expect but you can quickly modify the columns as needed. It appears that your error is caused by an item in your .txt file not evident in your example. Modify columns: You mentioned that you wanted five columns so I am assuming you would like to do the following once you read your .txt file: df[,4] <- paste0(df$V4,df$V5) df[,5] <- paste0(df$V6,df$V7) df <- df[,1:5] > df V1 V2 V3 V4 V5 1 4 A009 1 Cholera,unspecified Cholera,unspecified
R correct use of read.csv
I must be misunderstanding how read.csv works in R. I have read the help file, but still do not understand how a csv file containing: 40900,-,-,-,241.75,0 40905,244,245.79,241.25,244,22114 40906,244,246.79,243.6,245.5,18024 40907,246,248.5,246,247,60859 read into R using: euk<-data.matrix(read.csv("path\to\csv.csv")) produces this as a result (using tail): Date Open High Low Close Volume [2713,] 15329 490 404 369 240.75 62763 [2714,] 15330 495 409 378 242.50 127534 [2715,] 15331 1 1 1 241.75 0 [2716,] 15336 504 425 385 244.00 22114 [2717,] 15337 504 432 396 245.50 18024 [2718,] 15338 512 442 405 247.00 60859 It must be something obvious that I do not understand. Please be kind in your responses, I am trying to learn. Thanks!
The issue is not with read.csv, but with data.matrix. read.csv imports any column with characters in it as a factor. The '-' in the first row for your dataset are character, so the column is converted to a factor. Now, you pass the result of the read.csv into data.matrix, and as the help states, it replaces the levels of the factor with it's internal codes. Basically, you need to insure that the columns of your data are numeric before you pass the data.frame into data.matrix. This should work in your case (assuming the only characters are '-'): euk <- data.matrix(read.csv("path/to/csv.csv", na.strings = "-", colClasses = 'numeric'))
I'm no R expert, but you may consider using scan() instead, eg: > data = scan("foo.csv", what = list(x = numeric(), y = numeric()), sep = ",") Where foo.csv has two columns, x and y, and is comma delimited. I hope that helps.
I took a cut/paste of your data, put it in a file and I get this using 'R' > c<-data.matrix(read.csv("c:/DOCUME~1/Philip/LOCALS~1/Temp/x.csv",header=F)) > c V1 V2 V3 V4 V5 V6 [1,] 40900 1 1 1 241.75 0 [2,] 40905 2 2 2 244.00 22114 [3,] 40906 2 3 3 245.50 18024 [4,] 40907 3 4 4 247.00 60859 > There must be more in your data file, for one thing, data for the header line. And the output you show seems to start with row 2713. I would check: The format of the header line, or get rid of it and add it manually later. That each row has exactly 6 values. The the filename uses forward slashes and has no embedded spaces (use the 8.3 representation as shown in my filename). Also, if you generated your csv file from MS Excel, the internal representation for a date is a number.
Use the string of characters from a cell in a dataframe to create a vector
>titletool<-read.csv("TotalCSVData.csv",header=FALSE,sep=",") > class(titletool) [1] "data.frame" >titletool[1,1] [1] Experiment name : CONTROL DB AD_1 >t<-titletool[1,1] >t [1] Experiment name : CONTROL DB AD_1 >class(t) [1] "character" now i want to create an object (vector) with the name "Experiment name : CONTROL DB AD_1" , or even better if possible CONTROL DB AD_1 Thank you
Use assign: varname <- "Experiment name : CONTROL DB AD_1" assign(varname, 3.14158) get("Experiment name : CONTROL DB AD_1") [1] 3.14158 And you can use a regular expression and sub or gsub to remove some text from a string: cleanVarname <- sub("Experiment name : ", "", varname) assign(cleanVarname, 42) get("CONTROL DB AD_1") [1] 42 But let me warn you this is an unusual thing to do. Here be dragons.
If I understand correctly, you have a bunch of CSV files, each with multiple experiments in them, named in the pattern "Experiment ...". You now want to read each of these "experiments" into R in an efficient way. Here's a not-so-pretty (but not-so-ugly either) function that might get you started in the right direction. What the function basically does is read in the CSV, identify the line numbers where each new experiment starts, grabs the names of the experiments, then does a loop to fill in a list with the separate data frames. It doesn't really bother making "R-friendly" names though, and I've decided to leave the output in a list, because as Andrie pointed out, "R has great tools for working with lists." read.funkyfile = function(funkyfile, expression, ...) { temp = readLines(funkyfile) temp.loc = grep(expression, temp) temp.loc = c(temp.loc, length(temp)+1) temp.nam = gsub("[[:punct:]]", "", grep(expression, temp, value=TRUE)) temp.out = vector("list") for (i in 1:length(temp.nam)) { temp.out[[i]] = read.csv(textConnection( temp[seq(from = temp.loc[i]+1, to = temp.loc[i+1]-1)]), ...) names(temp.out)[i] = temp.nam[i] } temp.out } Here is an example CSV file. Copy and paste it into a text editor and save it as "funkyfile1.csv" in the current working directory. (Or, read it in from Dropbox: http://dl.dropbox.com/u/2556524/testing/funkyfile1.csv) "Experiment Name: Here Be",, 1,2,3 4,5,6 7,8,9 "Experiment Name: The Dragons",, 10,11,12 13,14,15 16,17,18 Here is a second CSV. Again, copy-paste and save it as "funkyfile2.csv" in your current working directory. (Or, read it in from Dropbox: http://dl.dropbox.com/u/2556524/testing/funkyfile2.csv) "Promises: I vow to",, "H1","H2","H3" 19,20,21 22,23,24 25,26,27 "Promises: Slay the dragon",, "H1","H2","H3" 28,29,30 31,32,33 34,35,36 Notice that funkyfile1 has no column names, while funkyfile2 does. That's what the ... argument in the function is for: to specify header=TRUE or header=FALSE. Also the "expression" identifying each new set of data is "Promises" in funkyfile2. Now, use the function: read.funkyfile("funkyfile1.csv", "Experiment", header=FALSE) # read.funkyfile("http://dl.dropbox.com/u/2556524/testing/funkyfile1.csv", # "Experiment", header=FALSE) # Uncomment to load remotely # $`Experiment Name Here Be` # V1 V2 V3 # 1 1 2 3 # 2 4 5 6 # 3 7 8 9 # # $`Experiment Name The Dragons` # V1 V2 V3 # 1 10 11 12 # 2 13 14 15 # 3 16 17 18 read.funkyfile("funkyfile2.csv", "Promises", header=TRUE) # read.funkyfile("http://dl.dropbox.com/u/2556524/testing/funkyfile2.csv", # "Experiment", header=TRUE) # Uncomment to load remotely # $`Promises I vow to` # H1 H2 H3 # 1 19 20 21 # 2 22 23 24 # 3 25 26 27 # # $`Promises Slay the dragon` # H1 H2 H3 # 1 28 29 30 # 2 31 32 33 # 3 34 35 36 Go get those dragons. Update If your data are all in the same format, you can use the lapply solution mentioned by Andrie along with this function. Just make a list of the CSVs that you want to load, as below. Note that the files all need to use the same "expression" and other arguments the way the function is currently written.... temp = list("http://dl.dropbox.com/u/2556524/testing/funkyfile1.csv", "http://dl.dropbox.com/u/2556524/testing/funkyfile3.csv") lapply(temp, read.funkyfile, "Experiment", header=FALSE)
R - pipe("pbcopy") columns not lining up with pasting
As a follow-up to a question I wrote a few days ago, I finally figured out how to copy to the clipboard to paste into other applications (read: Excel). However, when using the function to copy and paste, the variable column headers are not lining up correctly when pasting. Data (taken from a Flowing Data example I happened to be looking at): data <- read.csv("http://datasets.flowingdata.com/post-data.txt") Copy function: write.table(file = pipe("pbcopy"), data, sep = "\t") When loaded in, the data looks like this: id views comments category 1 5019 148896 28 Artistic Visualization 2 1416 81374 26 Visualization 3 1416 81374 26 Featured 4 3485 80819 37 Featured 5 3485 80819 37 Mapping 6 3485 80819 37 Data Sources There is a row number without a column variable name (1, 2, 3, 4, ...) Using the read.table(pipe("pbpaste")) function, it will load back into R fine. However, when I paste it into Excel, or TextEdit, the column name for the second variable will be in the first variable column name slot, like this: id views comments category 1 5019 148896 28 Artistic Visualization 2 1416 81374 26 Visualization 3 1416 81374 26 Featured 4 3485 80819 37 Featured 5 3485 80819 37 Mapping 6 3485 80819 37 Data Sources Which leaves the trailing column without a column name. Is there a way to ensure the data copied to the clipboard is aligned and labeled correctly?
The row numbers do not have a column name in an R data.frame. They were not in the original dataset but they are put into the output to the clipboard unless you suppress it. The default for that option is set to TRUE but you can override it. If you want such a column as a named column, you need to make it. Try this when sending to excel. df$rownums <- rownames(df) edf <- df[ c( length(df), 1:(length(df)-1))] # to get the rownums/rownames first write.table(file = pipe("pbcopy"), edf, row.names=FALSE, sep = "\t")
You may just want to add the argument col.names=NA to your call to write.table(). It has the effect of adding an empty character string (a blank column name) to the header row for the first column. write.table(file = pipe("pbcopy"), data, sep = "\t", col.names=NA) To see the difference, compare these two function calls: write.table(data[1:2,], sep="\t") # "id" "views" "comments" "category" # "1" 5019 148896 28 "Artistic Visualization" # "2" 1416 81374 26 "Visualization" write.table(data[1:2,], sep="\t", col.names=NA) # "" "id" "views" "comments" "category" # "1" 5019 148896 28 "Artistic Visualization" # "2" 1416 81374 26 "Visualization"