Hello please find below mentioned code. What I want is to add values to my array on the basis of certain condition checks which I want to undertake. If the values are eligible, then they should add to array otherwise they should be discarded. However, I am unable to get the required array. Any help in that regard will be of great help.
>NODE_1
[1]GTTGGCCGAGCCCCAGGACGCGTGGTTGTTGAACCAGATCAGGTCCGGGCTCCACTGCACGTAGTCCTCTTCCCAATTTCCCTTAA
>NODE_2
[1] CCTCCGGCGGCACCACGGTCGGCGAGGCCCTCAACATCCTG GAGCGCACCGACCTGTCCACCGCGGACAAGGCCGGTTACCT
GCACCGCTACATCGAGGCCAGCCGCATCGCGTTCGCGGACC
>NODE_3
[1]GCCCGGCGCCTGGCCGCGGGCGAGTGGGTCGTGGACCTGCGCTCCCGGGTGGCCTTCGCCGCCGGTCACGTCGCCGGG
TCGCTCAACTTCGAGGCCGACGGACAGCT
My code is:
Length <- function(a)
{
b<-list()
for ( i in 1: length(a))
{
b[i]<-which(length(a[i])<30, arr.ind = FALSE, useNames = TRUE)
m<- array(b[i])
}
}
k<- Length(Y)
So what I want to do is add only those data to array b from Y whose length is less than 30.
you should use nchar() instead of length() to get the number of characters.
And to do it the R way, you could use the boolean index: k <- a[nchar(a)<30]
Hope that helps!
Related
Wrote this function lockdown_func(beta.hat_func).
First thing is: I get an error "argument is of length zero".
Second thing is: when I compute it without the date indices, it doesn't change the value as it should, output vector contains same value for every indices.
date= c(seq(from=30, to=165))
beta.hat_func <- c(rep(x = beta.hat, times = 135))
beta.hat <- beta0[which.min(SSE)]
#implement function for modeling
lockdown_func <- function(beta.hat_func,l){
h=beta.hat_func
{
for(i in 1:length(h))
if(date[i]>60 | date[i]<110){
beta.hat_func[i]=beta.hat_func[i]*exp(-l*(date[i]-date[i-1]))
}else{
beta.hat_func[i]=beta.hat_func[i]
}
return(h)
}
}
lockdown_func(beta.hat_func,0.03)
A few comments:
did you mean to apply an AND rather than an OR to get date range between 60 and 110? This would be date[i]>60 && date[i]<110 (it's better to use the double-&& if you are computing a length-1 logical value)
because you didn't, i=1 satisfies the criterion, so date[i-1] will refer to date[0], which is a length-0 vector.
You might want something like:
l_dates <- date>60 & date<110 ## single-& here for vectorized operation
beta.hat_func[l_dates] <- beta.hat_func[l_dates]*exp(-l*diff(date)[l_dates])
Let's consider very easy function following :
easy_function=function(vec,string){
if (string=='some_string') sum(vec)
else if (string=='string_some') 3*max(vec)
else if (string=='some_string_some') mean(sum(vec),max(vec))
}
what I want to do is to create another function find_biggest<-function(vec) which goes through all possible strings in easy_function() and returns list with objects :
(1) string for which maximum is reached
(2) value of maximum.
My work so far
It's very easy to obtain second point. Just like the following :
find_biggest<-function(vec){
max(easy_function(vec,'some_string'),easy_function(vec,'string_some'),
easy_function(vec,'some_string_some'))
}
However, I have no idea, how can I obtain for which string, maximum was reached. Could you help me getting so ?
For example find_biggest(1:3) should return list with objects :
(1) 'string_some' (it's the string for which maximum is reached)
(2) 9 (it's the maximum)
How about this:
library(tidyverse)
easy_function=function(vec,string){
if (string=='some_string') sum(vec)
else if (string=='string_some') 3*max(vec)
else if (string=='some_string_some') mean(sum(vec),max(vec))
}
find_biggest <- function(vec){
strings <- c("some_string", "string_some", "some_string_some")
all_vals <- strings %>% map(easy_function, vec = vec) %>% unlist
list(max_string = strings[which.max(all_vals)],
max_val = max(all_vals))
}
find_biggest(1:10)
As a minimal example lets consider the following multiway array (a):
a = as.table(array(c(1:8), dim=c(2,2,2)))
For this array manual subindicing is easy, e.g.
a[1,,] (a 2 x 2 matrix that comply with dimension one being in state 1 (A))
My question is now; how can I do the same thing with a vector that preserves blanks, e.g. something like c(1,,).
Note that I need to define which dimentions are left blank (dynamically) based on the observed variables in an instance; My initial thought was a generic cha. vector b=c("","","") , where I could replace variable 1 with 1 if it was observed as in state 1, e.g. b[1]="1", but, first of all, I do not know how to use this vector for indicing a["b"], or whether there is a better way of doing this.
I need this dynamic indicing, because I want to update parts of the table as I receive evidence (information == counts)
Thank you very much in advance!
Best,
Sebastian
Here's how I would do it:
while (evidence) {
idx <- lapply(dim(a), function (dimsize) 1:dimsize)
## update `idx` according to `evidence`, e.g.,
## if you want to do `a[1,,2]`
idx[[1]] <- 1
idx[[3]] <- 2
do.call(`[`, c(list(a), idx))
## if you want to do `a[1,,2] <- c(20, 30)`
a <- do.call(`[<-`, c(list(a), idx, list(value=c(20, 30))))
}
Here is a dirty way of solving it:
data:
a = as.table(array(c(1:8), dim=c(2,2,2)))
Your dynamic indices should be a text: (that's a new question of how you get your condition into a string like index, index2)
index = "1,,"
index2 = ",2,"
function:
crazyIndexing <- function(obj, index) {
stringExpr = paste0(obj, "[",index,"]")
return(eval(parse(text=stringExpr)))
}
call your function: (see how it does the same!)
a[1,,]
crazyIndexing("a",index)
a[,2,]
crazyIndexing("a",index2)
please note:
b=c("","",""); b[1]="1"
index = paste0(b, collapse = ",")
#[1] "1,,"
You can of course change your function accordingly:
crazyIndexing2 <- function(obj, obj2, index) {
stringExpr = paste0(obj ,"[",index,"]", "<-", obj, "[",index,"]", "+", obj2)
eval(parse(text=stringExpr))
return( get(obj) )
}
a = as.table(array(c(1:8), dim=c(2,2,2)))
aa = a[,2,]
aopt = crazyIndexing2("a","aa","1,,")
Now you have all the tools.
I am trying to create a function that will check if the length of my list is 2, and if so, it goes on to the next step. I haven't written the next steps, as I can't get the first step to accurately check. Here is what I have come up with so far:
my_function <- function(x) {
if(length(x) <- 2) {
return("Correct Length")
}
}
When I run this function with:
my_function(list(c(3)))
my_function(list(c("text")))
my_function(list(c(6, 7), c(2, 4)))
I get the following results:
[1] "Correct Length"
[1] "Correct Length"
[1] "Correct Length"
I am sure this is how I am measuring my length, but if I try to add 'list' to the code. I am not sure why my function is evaluating the first two items as TRUE, as only the their input should evaluate to TRUE.
Any suggestions would be help as I continue to learn.
<- is used for assigning values to variables, == is used for checking equality. Your check should thus be
if (length(x) == 2) {
...
}
When working with R I frequently get the error message "subscript out of bounds". For example:
# Load necessary libraries and data
library(igraph)
library(NetData)
data(kracknets, package = "NetData")
# Reduce dataset to nonzero edges
krack_full_nonzero_edges <- subset(krack_full_data_frame, (advice_tie > 0 | friendship_tie > 0 | reports_to_tie > 0))
# convert to graph data farme
krack_full <- graph.data.frame(krack_full_nonzero_edges)
# Set vertex attributes
for (i in V(krack_full)) {
for (j in names(attributes)) {
krack_full <- set.vertex.attribute(krack_full, j, index=i, attributes[i+1,j])
}
}
# Calculate reachability for each vertix
reachability <- function(g, m) {
reach_mat = matrix(nrow = vcount(g),
ncol = vcount(g))
for (i in 1:vcount(g)) {
reach_mat[i,] = 0
this_node_reach <- subcomponent(g, (i - 1), mode = m)
for (j in 1:(length(this_node_reach))) {
alter = this_node_reach[j] + 1
reach_mat[i, alter] = 1
}
}
return(reach_mat)
}
reach_full_in <- reachability(krack_full, 'in')
reach_full_in
This generates the following error Error in reach_mat[i, alter] = 1 : subscript out of bounds.
However, my question is not about this particular piece of code (even though it would be helpful to solve that too), but my question is more general:
What is the definition of a subscript-out-of-bounds error? What causes it?
Are there any generic ways of approaching this kind of error?
This is because you try to access an array out of its boundary.
I will show you how you can debug such errors.
I set options(error=recover)
I run reach_full_in <- reachability(krack_full, 'in')
I get :
reach_full_in <- reachability(krack_full, 'in')
Error in reach_mat[i, alter] = 1 : subscript out of bounds
Enter a frame number, or 0 to exit
1: reachability(krack_full, "in")
I enter 1 and I get
Called from: top level
I type ls() to see my current variables
1] "*tmp*" "alter" "g"
"i" "j" "m"
"reach_mat" "this_node_reach"
Now, I will see the dimensions of my variables :
Browse[1]> i
[1] 1
Browse[1]> j
[1] 21
Browse[1]> alter
[1] 22
Browse[1]> dim(reach_mat)
[1] 21 21
You see that alter is out of bounds. 22 > 21 . in the line :
reach_mat[i, alter] = 1
To avoid such error, personally I do this :
Try to use applyxx function. They are safer than for
I use seq_along and not 1:n (1:0)
Try to think in a vectorized solution if you can to avoid mat[i,j] index access.
EDIT vectorize the solution
For example, here I see that you don't use the fact that set.vertex.attribute is vectorized.
You can replace:
# Set vertex attributes
for (i in V(krack_full)) {
for (j in names(attributes)) {
krack_full <- set.vertex.attribute(krack_full, j, index=i, attributes[i+1,j])
}
}
by this:
## set.vertex.attribute is vectorized!
## no need to loop over vertex!
for (attr in names(attributes))
krack_full <<- set.vertex.attribute(krack_full,
attr, value = attributes[,attr])
It just means that either alter > ncol( reach_mat ) or i > nrow( reach_mat ), in other words, your indices exceed the array boundary (i is greater than the number of rows, or alter is greater than the number of columns).
Just run the above tests to see what and when is happening.
Only an addition to the above responses: A possibility in such cases is that you are calling an object, that for some reason is not available to your query. For example you may subset by row names or column names, and you will receive this error message when your requested row or column is not part of the data matrix or data frame anymore.
Solution: As a short version of the responses above: you need to find the last working row name or column name, and the next called object should be the one that could not be found.
If you run parallel codes like "foreach", then you need to convert your code to a for loop to be able to troubleshoot it.
If this helps anybody, I encountered this while using purr::map() with a function I wrote which was something like this:
find_nearby_shops <- function(base_account) {
states_table %>%
filter(state == base_account$state) %>%
left_join(target_locations, by = c('border_states' = 'state')) %>%
mutate(x_latitude = base_account$latitude,
x_longitude = base_account$longitude) %>%
mutate(dist_miles = geosphere::distHaversine(p1 = cbind(longitude, latitude),
p2 = cbind(x_longitude, x_latitude))/1609.344)
}
nearby_shop_numbers <- base_locations %>%
split(f = base_locations$id) %>%
purrr::map_df(find_nearby_shops)
I would get this error sometimes with samples, but most times I wouldn't. The root of the problem is that some of the states in the base_locations table (PR) did not exist in the states_table, so essentially I had filtered out everything, and passed an empty table on to mutate. The moral of the story is that you may have a data issue and not (just) a code problem (so you may need to clean your data.)
Thanks for agstudy and zx8754's answers above for helping with the debug.
I sometimes encounter the same issue. I can only answer your second bullet, because I am not as expert in R as I am with other languages. I have found that the standard for loop has some unexpected results. Say x = 0
for (i in 1:x) {
print(i)
}
The output is
[1] 1
[1] 0
Whereas with python, for example
for i in range(x):
print i
does nothing. The loop is not entered.
I expected that if x = 0 that in R, the loop would not be entered. However, 1:0 is a valid range of numbers. I have not yet found a good workaround besides having an if statement wrapping the for loop
This came from standford's sna free tutorial
and it states that ...
# Reachability can only be computed on one vertex at a time. To
# get graph-wide statistics, change the value of "vertex"
# manually or write a for loop. (Remember that, unlike R objects,
# igraph objects are numbered from 0.)
ok, so when ever using igraph, the first roll/column is 0 other than 1, but matrix starts at 1, thus for any calculation under igraph, you would need x-1, shown at
this_node_reach <- subcomponent(g, (i - 1), mode = m)
but for the alter calculation, there is a typo here
alter = this_node_reach[j] + 1
delete +1 and it will work alright
What did it for me was going back in the code and check for errors or uncertain changes and focus on need-to-have over nice-to-have.