Replace matched string with its sub-groups - r

Question

I have some DNA sequences to process, they look like:
>KU508975.1 Acalypha australis maturase K (matK) gene, partial cds; chloroplast
TAAATTATGTGTCAGAGCTATTAATACCTTACCCCATCCATCTAGAAAAATGGGTTCAAATTCTTCGATA
TTGGCTGAAAGATCCCTCTTCTTTGCATTTATTACGACTCTTTCTTCATGAATATTGGAATTGGAACTGT
TTTCTTATTCCAAAGAAATCGATTGCTATTTTTACAAAAAGTAATCCAAGATTTTTCTTGTTTCTATATA
>KC747175.1 Achyranthes bidentata bio-material USDA:GRIN:PI613015 maturase K (matK) gene, partial cds; chloroplast
GATATATTAATACCTTACCCCGCTCATCTAGAAATCTTGGTTCAAACTCTCCGATACTGGTTGAAAGATG
CTTCTTCTTTGCATTTATTACGATTCTTTCTTTATGAGTGTCGTAATTGGATTAGTCTTATTACTCCAAA
AAAATCCATTTCCTTTTTGAAAAAAAGGAATCGAAGATTATTCTTGTTCCTATATAATTTCTATGTATGT
I coded a regex in order to detect the title line of each sequence:
(\>)([A-Z]{2}\d{6}\.?\d)\s([a-zA-Z]+\-?[a-zA-Z]+)\s([a-zA-Z]+\-?[a-zA-Z]+)\s(.*)\n
What function should I use to replace this whole match with its group3 + group4? In addition, I've got 72 matches in one txt file, how can I replace them in one run?

Answer 1

Your current regex won't work for lines where Group 3 or 4 contains a single letter word because [a-zA-Z]+\\-?[a-zA-Z]+ matches 1+ letters, then an optional hyphen, and then again 1+ letters (that means, there must be at least 2 letters). With [a-zA-Z]+(?:-[a-zA-Z]+)?, you can match 1+ letters followed with an optional sequence of - and then 1+ letters.
Also, \s also matches line breaks, and if your title lines are shorter than you assume then .* may grab a sequence line by mistake. You may use \h or [ \t] instead.
Note that \n is not necessary at the end of the pattern because .* matches any 0+ chars other than line break chars with an ICU regex library (it is used in your current code, str_replace_all).
In general, you should only capture with (...) what you need to keep, everything else can be just matched. Remove extra capturing parentheses, and it will save some performance.
If you add (?m)^ at the start, you will make sure you only match > that is at the start of a line.
You may use
"(?m)^>[A-Z]{2}\\d{6}\\.?\\d\\h+([a-zA-Z]+(?:-[a-zA-Z]+)?)\\h+([a-zA-Z]+(?:-[a-zA-Z]+)?).*"
See the regex demo.
Code:
Sequence <- str_replace_all(SequenceRaw,
"(?m)^>[A-Z]{2}\\d{6}\\.?\\d\\h+([a-zA-Z]+(?:-[a-zA-Z]+)?)\\h+([a-zA-Z]+(?:-[a-zA-Z]+)?).*",
"\\1 \\2")

Answer 2

I figured it out myself, with tidyverse packages:
library(tidyverse)
SequenceRaw <- read_file("PATH OF SEQUENCE FILE\\sequenceraw.fasta") ## e.g. sequenceraw.fasta
Sequence <- str_replace_all(SequenceRaw,
"(\\>)([A-Z]{2}\\d{6}\\.?\\d)\\s([a-zA-Z]+\\-?[a-zA-Z]+)\\s([a-zA-Z]+\\-?[a-zA-Z]+)\\s(.*)\\n",
">\\3 \\4\n") ## Keep '>' and add a new line with '\n'
write_file(Sequence, "YOUR PATH\\sequence.fasta")
Here is the result: